X-38269511-TATTAAGTCTTATATCTTTTAA-T

Position:

• chrX-38269511-TATTAAGTCTTATATCTTTTAA-T

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000328.3(RPGR):​c.*94_*114delTTAAAAGATATAAGACTTAAT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 23)
• Consequence: RPGR NM_000328.3 3_prime_UTR
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 1.37

Genes affected

ENSG00000250349 (HGNC:):

RPGR (HGNC:10295): (retinitis pigmentosa GTPase regulator) This gene encodes a protein with a series of six RCC1-like domains (RLDs), characteristic of the highly conserved guanine nucleotide exchange factors. The encoded protein is found in the Golgi body and interacts with RPGRIP1. This protein localizes to the outer segment of rod photoreceptors and is essential for their viability. Mutations in this gene have been associated with X-linked retinitis pigmentosa (XLRP). Multiple alternatively spliced transcript variants that encode different isoforms of this gene have been reported, but the full-length natures of only some have been determined. [provided by RefSeq, Dec 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RPGR	NM_000328.3	c.*94_*114delTTAAAAGATATAAGACTTAAT		3_prime_UTR_variant	19/19		NP_000319.1
RPGR	NM_001367245.1	c.*94_*114delTTAAAAGATATAAGACTTAAT		3_prime_UTR_variant	19/19		NP_001354174.1
RPGR	NM_001367246.1	c.*94_*114delTTAAAAGATATAAGACTTAAT		3_prime_UTR_variant	18/18		NP_001354175.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ENSG00000250349	ENST00000465127.1	c.172-396608_172-396588delTTAAGTCTTATATCTTTTAAA		intron_variant		5		ENSP00000417050.1

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

not provided Other:1

not provided, no classification provided

literature only

Retina International

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs281865316; hg19: chrX-38128764;