chrX-38269511-TATTAAGTCTTATATCTTTTAA-T
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_000328.3(RPGR):c.*94_*114delTTAAAAGATATAAGACTTAAT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars). The gene RPGR is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000328.3 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- retinitis pigmentosa 3Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae), PanelApp Australia
- RPGR-related retinopathyInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- primary ciliary dyskinesia-retinitis pigmentosa syndromeInheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
- cone-rod dystrophyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- primary ciliary dyskinesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- retinitis pigmentosaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- macular degeneration, X-linked atrophicInheritance: XL Classification: LIMITED Submitted by: G2P
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000328.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RPGR | c.*94_*114delTTAAAAGATATAAGACTTAAT | 3_prime_UTR | Exon 19 of 19 | NP_000319.1 | Q92834-2 | ||||
| RPGR | c.*94_*114delTTAAAAGATATAAGACTTAAT | 3_prime_UTR | Exon 19 of 19 | NP_001354174.1 | |||||
| RPGR | c.*94_*114delTTAAAAGATATAAGACTTAAT | 3_prime_UTR | Exon 18 of 18 | NP_001354175.1 | Q92834-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ENSG00000250349 | TSL:5 | c.172-396608_172-396588delTTAAGTCTTATATCTTTTAAA | intron | N/A | ENSP00000417050.1 | B4E171 | |||
| RPGR | TSL:5 | c.*94_*114delTTAAAAGATATAAGACTTAAT | 3_prime_UTR | Exon 18 of 18 | ENSP00000343671.3 | Q92834-1 | |||
| RPGR | c.*94_*114delTTAAAAGATATAAGACTTAAT | 3_prime_UTR | Exon 19 of 19 | ENSP00000493468.2 | Q92834-2 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 genome Cov.: 23
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at