X-48509868-CTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA-C

Variant names:

• chrX-48509868-CTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA-C
• rs2061661681
• NM_203475.3:c.49_80delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_203475.3(PORCN):​c.49_80delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA​(p.Cys17ProfsTer84) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 22)
• Consequence: PORCN NM_203475.3 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 8.71

Genes affected

PORCN (HGNC:17652): (porcupine O-acyltransferase) This gene belongs to the evolutionarily conserved porcupine (Porc) gene family. Genes of the porcupine family encode endoplasmic reticulum proteins with multiple transmembrane domains. Porcupine proteins are involved in the processing of Wnt (wingless and int homologue) proteins. Disruption of this gene is associated with focal dermal hypoplasia, and the encoded protein has been implicated in cancer. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2013]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 51 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-48509868-CTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA-C is Pathogenic according to our data. Variant chrX-48509868-CTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA-C is described in ClinVar as [Pathogenic]. Clinvar id is 998041.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PORCN	NM_203475.3	c.49_80delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA	p.Cys17ProfsTer84	frameshift_variant	Exon 2 of 15	ENST00000326194.11	NP_982301.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PORCN	ENST00000326194.11	c.49_80delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA	p.Cys17ProfsTer84	frameshift_variant	Exon 2 of 15	1	NM_203475.3	ENSP00000322304.6

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Focal dermal hypoplasia Pathogenic:1

May 31, 2019

Beijing Key Laboratory for Genetic Research of Skeletal Deformity, Peking Union Medical College Hospital

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2061661681; hg19: chrX-48368256;