chrX-48509868-CTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA-C
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_203475.3(PORCN):c.49_80delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA(p.Cys17ProfsTer84) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_203475.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- focal dermal hypoplasiaInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics, Orphanet
- microphthalmia, isolated, with colobomaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_203475.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PORCN | MANE Select | c.49_80delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA | p.Cys17ProfsTer84 | frameshift | Exon 2 of 15 | NP_982301.1 | Q9H237-1 | ||
| PORCN | c.388_419delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA | p.Cys130ProfsTer84 | frameshift | Exon 2 of 14 | NP_001428262.1 | ||||
| PORCN | c.388_419delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA | p.Cys130ProfsTer84 | frameshift | Exon 2 of 13 | NP_001428263.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PORCN | TSL:1 MANE Select | c.49_80delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA | p.Cys17ProfsTer84 | frameshift | Exon 2 of 15 | ENSP00000322304.6 | Q9H237-1 | ||
| PORCN | TSL:1 | c.49_80delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA | p.Cys17ProfsTer84 | frameshift | Exon 2 of 14 | ENSP00000348233.4 | Q9H237-2 | ||
| PORCN | TSL:1 | c.49_80delTGTCTCCTGCCTACTGCCCAGCAGGGCCTTGA | p.Cys17ProfsTer84 | frameshift | Exon 2 of 13 | ENSP00000356546.6 | Q9H237-4 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at