X-48683870-TGGGAGGAAGGCCCGGGGGCCGAG-T

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_StrongPM2PP5_Moderate

The NM_000377.3(WAS):​c.19_41delGGAGGAAGGCCCGGGGGCCGAGG​(p.Gly7SerfsTer23) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 22)

Consequence

WAS
NM_000377.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 4.90
Variant links:
Genes affected
WAS (HGNC:12731): (WASP actin nucleation promoting factor) The Wiskott-Aldrich syndrome (WAS) family of proteins share similar domain structure, and are involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton. The presence of a number of different motifs suggests that they are regulated by a number of different stimuli, and interact with multiple proteins. Recent studies have demonstrated that these proteins, directly or indirectly, associate with the small GTPase, Cdc42, known to regulate formation of actin filaments, and the cytoskeletal organizing complex, Arp2/3. Wiskott-Aldrich syndrome is a rare, inherited, X-linked, recessive disease characterized by immune dysregulation and microthrombocytopenia, and is caused by mutations in the WAS gene. The WAS gene product is a cytoplasmic protein, expressed exclusively in hematopoietic cells, which show signalling and cytoskeletal abnormalities in WAS patients. A transcript variant arising as a result of alternative promoter usage, and containing a different 5' UTR sequence, has been described, however, its full-length nature is not known. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 15 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant X-48683870-TGGGAGGAAGGCCCGGGGGCCGAG-T is Pathogenic according to our data. Variant chrX-48683870-TGGGAGGAAGGCCCGGGGGCCGAG-T is described in ClinVar as [Pathogenic]. Clinvar id is 2030805.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
WASNM_000377.3 linkc.19_41delGGAGGAAGGCCCGGGGGCCGAGG p.Gly7SerfsTer23 frameshift_variant Exon 1 of 12 ENST00000376701.5 NP_000368.1 P42768A0A024QYX8

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
WASENST00000376701.5 linkc.19_41delGGAGGAAGGCCCGGGGGCCGAGG p.Gly7SerfsTer23 frameshift_variant Exon 1 of 12 1 NM_000377.3 ENSP00000365891.4 P42768

Frequencies

GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Wiskott-Aldrich syndrome;C1839163:Thrombocytopenia 1;C1845987:X-linked severe congenital neutropenia Pathogenic:1
Sep 16, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Gly7Serfs*23) in the WAS gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in WAS are known to be pathogenic (PMID: 15284122). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with WAS-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-48542259; API