chrX-48683870-TGGGAGGAAGGCCCGGGGGCCGAG-T

Variant names:

• chrX-48683870-TGGGAGGAAGGCCCGGGGGCCGAG-T
• NM_000377.3:c.19_41delGGAGGAAGGCCCGGGGGCCGAGG

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_000377.3(WAS):​c.19_41delGGAGGAAGGCCCGGGGGCCGAGG​(p.Gly7SerfsTer23) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: WAS NM_000377.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.90

Genes affected

WAS (HGNC:12731): (WASP actin nucleation promoting factor) The Wiskott-Aldrich syndrome (WAS) family of proteins share similar domain structure, and are involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton. The presence of a number of different motifs suggests that they are regulated by a number of different stimuli, and interact with multiple proteins. Recent studies have demonstrated that these proteins, directly or indirectly, associate with the small GTPase, Cdc42, known to regulate formation of actin filaments, and the cytoskeletal organizing complex, Arp2/3. Wiskott-Aldrich syndrome is a rare, inherited, X-linked, recessive disease characterized by immune dysregulation and microthrombocytopenia, and is caused by mutations in the WAS gene. The WAS gene product is a cytoplasmic protein, expressed exclusively in hematopoietic cells, which show signalling and cytoskeletal abnormalities in WAS patients. A transcript variant arising as a result of alternative promoter usage, and containing a different 5' UTR sequence, has been described, however, its full-length nature is not known. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 15 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-48683870-TGGGAGGAAGGCCCGGGGGCCGAG-T is Pathogenic according to our data. Variant chrX-48683870-TGGGAGGAAGGCCCGGGGGCCGAG-T is described in ClinVar as [Pathogenic]. Clinvar id is 2030805.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
WAS	NM_000377.3	c.19_41delGGAGGAAGGCCCGGGGGCCGAGG	p.Gly7SerfsTer23	frameshift_variant	Exon 1 of 12	ENST00000376701.5	NP_000368.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
WAS	ENST00000376701.5	c.19_41delGGAGGAAGGCCCGGGGGCCGAGG	p.Gly7SerfsTer23	frameshift_variant	Exon 1 of 12	1	NM_000377.3	ENSP00000365891.4

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Wiskott-Aldrich syndrome;C1839163:Thrombocytopenia 1;C1845987:X-linked severe congenital neutropenia Pathogenic:1

Sep 16, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Gly7Serfs*23) in the WAS gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in WAS are known to be pathogenic (PMID: 15284122). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with WAS-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-48542259;