X-48902256-AGCCATGACAAGTCGGACAGGG-AGCCATGACAAGTCGGACAGGGGCCATGACAAGTCGGACAGGG

Position:

• chrX-48902256-AGCCATGACAAGTCGGACAGGG-AGCCATGACAAGTCGGACAGGGGCCATGACAAGTCGGACAGGG

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_001032382.2(PQBP1):​c.334_354dupAGGGGCCATGACAAGTCGGAC​(p.Arg119_Ser120insGlyHisAspLysSerAspArg) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., 0 hem., cov: 22)
  • Failed GnomAD Quality Control
• Consequence: PQBP1 NM_001032382.2 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.338

Genes affected

PQBP1 (HGNC:9330): (polyglutamine binding protein 1) This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]

PQBP1 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001032382.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PQBP1	NM_001032382.2	c.334_354dupAGGGGCCATGACAAGTCGGAC	p.Arg119_Ser120insGlyHisAspLysSerAspArg	conservative_inframe_insertion	5/7	ENST00000447146.7	NP_001027554.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PQBP1	ENST00000447146.7	c.334_354dupAGGGGCCATGACAAGTCGGAC	p.Arg119_Ser120insGlyHisAspLysSerAspArg	conservative_inframe_insertion	5/7	1	NM_001032382.2	ENSP00000391759.2

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 110669 Hom.: 0 Cov.: 22 AF XY: 0.00 AC XY: 0 AN XY: 32919 FAILED QC

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 35

GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 110669 Hom.: 0 Cov.: 22 AF XY: 0.00 AC XY: 0 AN XY: 32919

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

May 24, 2021

Not observed at significant frequency in large population cohorts (Lek et al., 2016); Has not been previously published as pathogenic or benign to our knowledge; In-frame insertion of 7 amino acids in a tandem repeat -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-48759533;