rs606231198

Variant names:

• chrX-48902256-AGCCATGACAAGTCGGACAGGG-A
• rs606231198
• NM_001032382.2:c.334_354delAGGGGCCATGACAAGTCGGAC

Your query was ambiguous. Multiple possible variants found:

• chrX-48902256-AGCCATGACAAGTCGGACAGGG-A
• chrX-48902256-AGCCATGACAAGTCGGACAGGG-AGCCATGACAAGTCGGACAGGGGCCATGACAAGTCGGACAGGG

Variant summary

Our verdict is Benign. The variant received -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BS1 BS2

The NM_001032382.2(PQBP1):​c.334_354delAGGGGCCATGACAAGTCGGAC​(p.Arg112_Asp118del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.000784 in 1,208,929 control chromosomes in the GnomAD database, including 3 homozygotes. There are 426 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.00046 (1 hom., 17 hem., cov: 21)
  • Exomes 𝑓: 0.00082 (2 hom. 409 hem.)
• Consequence: PQBP1 NM_001032382.2 conservative_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts P:1 B:6
• Conservation: PhyloP100: 4.52
• Publications: 1 publications found

Genes affected

PQBP1 (HGNC:9330): (polyglutamine binding protein 1) This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]

PQBP1 Gene-Disease associations (from GenCC):

• Renpenning syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• hamel cerebro-palato-cardiac syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability, Golabi-Ito-hall type

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability, Porteous type

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability, Sutherland-Haan type

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001032382.2.
• BP6: Variant X-48902256-AGCCATGACAAGTCGGACAGGG-A is Benign according to our data. Variant chrX-48902256-AGCCATGACAAGTCGGACAGGG-A is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 10984.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.000461 (51/110709) while in subpopulation SAS AF = 0.00698 (18/2578). AF 95% confidence interval is 0.00451. There are 1 homozygotes in GnomAd4. There are 17 alleles in the male GnomAd4 subpopulation. Median coverage is 21. This position passed quality control check.
• BS2: High Hemizygotes in GnomAd4 at 17 XL gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001032382.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PQBP1	NM_001032382.2	MANE Select	c.334_354delAGGGGCCATGACAAGTCGGAC	p.Arg112_Asp118del	conservative_inframe_deletion	Exon 5 of 7	NP_001027554.1	O60828-1
	PQBP1	NM_001032381.2		c.334_354delAGGGGCCATGACAAGTCGGAC	p.Arg112_Asp118del	conservative_inframe_deletion	Exon 5 of 7	NP_001027553.1	A0A0S2Z4V5
	PQBP1	NM_001032383.2		c.334_354delAGGGGCCATGACAAGTCGGAC	p.Arg112_Asp118del	conservative_inframe_deletion	Exon 5 of 7	NP_001027555.1	O60828-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PQBP1	ENST00000447146.7	TSL:1 MANE Select	c.334_354delAGGGGCCATGACAAGTCGGAC	p.Arg112_Asp118del	conservative_inframe_deletion	Exon 5 of 7	ENSP00000391759.2	O60828-1
	PQBP1	ENST00000218224.9	TSL:1	c.334_354delAGGGGCCATGACAAGTCGGAC	p.Arg112_Asp118del	conservative_inframe_deletion	Exon 4 of 6	ENSP00000218224.4	O60828-1
	PQBP1	ENST00000463529.4	TSL:1	n.334_354delAGGGGCCATGACAAGTCGGAC		non_coding_transcript_exon	Exon 4 of 4

Frequencies

GnomAD3 genomes AF: 0.000461 AC: 51 AN: 110659 Hom.: 1 Cov.: 21

Gnomad AFR AF: 0.0000988

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00696

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000549

Gnomad OTH AF: 0.000672

GnomAD2 exomes AF: 0.000944 AC: 173 AN: 183289 AF XY: 0.00146

Gnomad AFR exome AF: 0.000152

Gnomad AMR exome AF: 0.000219

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000513

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000817 AC: 897 AN: 1098220 Hom.: 2 AF XY: 0.00112 AC XY: 409 AN XY: 363584

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000114 AC: 3 AN: 26401

American (AMR) AF: 0.000256 AC: 9 AN: 35199

Ashkenazi Jewish (ASJ) AF: 0.0000516 AC: 1 AN: 19385

East Asian (EAS) AF: 0.00 AC: 0 AN: 30206

South Asian (SAS) AF: 0.00728 AC: 394 AN: 54142

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 40529

Middle Eastern (MID) AF: 0.000725 AC: 3 AN: 4136

European-Non Finnish (NFE) AF: 0.000544 AC: 458 AN: 842127

Other (OTH) AF: 0.000629 AC: 29 AN: 46095

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000461 AC: 51 AN: 110709 Hom.: 1 Cov.: 21 AF XY: 0.000516 AC XY: 17 AN XY: 32975

African (AFR) AF: 0.0000986 AC: 3 AN: 30426

American (AMR) AF: 0.00 AC: 0 AN: 10368

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2634

East Asian (EAS) AF: 0.00 AC: 0 AN: 3514

South Asian (SAS) AF: 0.00698 AC: 18 AN: 2578

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 5972

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 215

European-Non Finnish (NFE) AF: 0.000549 AC: 29 AN: 52814

Other (OTH) AF: 0.000664 AC: 1 AN: 1507

Alfa AF: 0.000473 Hom.: 2

Bravo AF: 0.000423

EpiCase AF: 0.000981

EpiControl AF: 0.000593

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	2	not specified (2)
1	-	1	Renpenning syndrome (2)
-	-	1	PQBP1-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5
Mutation Taster		=139/61	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs606231198; hg19: chrX-48759533;