X-48902316-AGGGGCCACGACAAGTCAGACC-AGGGGCCACGACAAGTCAGACCGGGGCCACGACAAGTCAGACC

Variant names:

• chrX-48902316-A-AGGGGCCACGACAAGTCAGACC
• NM_001032382.2:c.393_413dupAGACCGGGGCCACGACAAGTC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_001032382.2(PQBP1):​c.393_413dupAGACCGGGGCCACGACAAGTC​(p.Ser138_Asp139insAspArgGlyHisAspLysSer) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 22)
  • Exomes 𝑓: 9.1e-7 (0 hom. 1 hem.)
  • Failed GnomAD Quality Control
• Consequence: PQBP1 NM_001032382.2 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.63

Genes affected

PQBP1 (HGNC:9330): (polyglutamine binding protein 1) This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001032382.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PQBP1	NM_001032382.2	c.393_413dupAGACCGGGGCCACGACAAGTC	p.Ser138_Asp139insAspArgGlyHisAspLysSer	disruptive_inframe_insertion	Exon 5 of 7	ENST00000447146.7	NP_001027554.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PQBP1	ENST00000447146.7	c.393_413dupAGACCGGGGCCACGACAAGTC	p.Ser138_Asp139insAspArgGlyHisAspLysSer	disruptive_inframe_insertion	Exon 5 of 7	1	NM_001032382.2	ENSP00000391759.2

Frequencies

GnomAD3 genomes Cov.: 22

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 9.11e-7 AC: 1 AN: 1098036 Hom.: 0 Cov.: 35 AF XY: 0.00000275 AC XY: 1 AN XY: 363406

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000331

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 22

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Oct 23, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.393_413dup, results in the insertion of 7 amino acid(s) of the PQBP1 protein (p.Gly134_Arg140dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with PQBP1-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-48759593;