X-48904529-TCACCCTACCAGGAAGGGTTCACGTGACACCCAGCTCTAGTCCCACACCCCTCCAGAAGTCTCAGTGACCTGGGAGAAAAGACCATCTCCCAAACCCAGAGGAGCCAGGCCCCGGAGGGTGGCGACTTGGGTCCTGCAGATGCCCAACACCCTCCACCCCAGTCCCCCTCCCTTGTGTCCCCCCATTGCTGCCAGCCCTCACTTCACCAGCACTGACTTTGGCAGAAAGGGCTCCGTGATGAGGTCTCCACGGTGGGAAGACAGCTGCGGTGGTGGTGGCTGCCC-CCTCCCG

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_005660.3(SLC35A2):c.1096_1163+217delinsCGGGAGG variant causes a splice donor, splice donor 5th base, coding sequence, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: SLC35A2 NM_005660.3 splice_donor, splice_donor_5th_base, coding_sequence, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.10

Genes affected

SLC35A2 (HGNC:11022): (solute carrier family 35 member A2) This gene encodes a member of the nucleotide-sugar transporter family. The encoded protein is a multi-pass membrane protein. It transports UDP-galactose from the cytosol into Golgi vesicles, where it serves as a glycosyl donor for the generation of glycans. Mutations in this gene cause congenital disorder of glycosylation type IIm (CDG2M). Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Oct 2014]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing variant, NOT destroyed by nmd, known LOF gene, truncates 0.5398824517212426 fraction of the gene. No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
SLC35A2	NM_005660.3	c.1096_1163+217delinsCGGGAGG		splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	4/5	ENST00000247138.11

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
SLC35A2	ENST00000247138.11	c.1096_1163+217delinsCGGGAGG		splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	4/5	1	NM_005660.3	P1

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

Dec 04, 2019

Not observed in large population cohorts (Lek et al., 2016); Frameshift variant predicted to result in protein truncation as the last 28 amino acids are lost and replaced with 10 incorrect amino acids, although loss-of-function variants have not been reported downstream of this position in the protein; Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-48761806;