X-54809985-AGCTGACACCAAGAAACAGAAT-A

Variant names:

• chrX-54809985-AGCTGACACCAAGAAACAGAAT-A
• NM_177433.3:c.316_336delACCAAGAAACAGAATGCTGAC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_177433.3(MAGED2):​c.316_336delACCAAGAAACAGAATGCTGAC​(p.Thr106_Asp112del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 21)
• Consequence: MAGED2 NM_177433.3 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.87

Genes affected

MAGED2 (HGNC:16353): (MAGE family member D2) This gene is a member of the MAGED gene family. The MAGED genes are clustered on chromosome Xp11. This gene is located in Xp11.2, a hot spot for X-linked intellectual disability (XLID). Mutations in this gene cause a form of transient antenatal Bartter's syndrome. This gene may also be involved in several types of cancer, including breast cancer and melanoma. The protein encoded by this gene is progressively recruited from the cytoplasm to the nucleoplasm during the interphase and after nucleolar stress and is thus thought to play a role in cell cycle regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2017]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_177433.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MAGED2	NM_177433.3	c.316_336delACCAAGAAACAGAATGCTGAC	p.Thr106_Asp112del	conservative_inframe_deletion	Exon 3 of 13	ENST00000375068.6	NP_803182.1
MAGED2	NM_014599.6	c.316_336delACCAAGAAACAGAATGCTGAC	p.Thr106_Asp112del	conservative_inframe_deletion	Exon 3 of 13		NP_055414.2
MAGED2	NM_201222.3	c.316_336delACCAAGAAACAGAATGCTGAC	p.Thr106_Asp112del	conservative_inframe_deletion	Exon 3 of 13		NP_957516.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MAGED2	ENST00000375068.6	c.316_336delACCAAGAAACAGAATGCTGAC	p.Thr106_Asp112del	conservative_inframe_deletion	Exon 3 of 13	1	NM_177433.3	ENSP00000364209.1

Frequencies

GnomAD3 genomes Cov.: 21

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 21

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Jan 06, 2021

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Not observed in large population cohorts (Lek et al., 2016); In-frame deletion of 7 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-54836418;