X-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCA
• rs3032358
• NM_000044.6:c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -13 ACMG points: 0P and 13B. BP3 BP6_Very_Strong BS2

The NM_000044.6(AR):​c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln72_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. Q80Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0018 (2 hom., 5 hem., cov: 0)
  • Exomes 𝑓: 0.00067 (0 hom. 42 hem.)
  • Failed GnomAD Quality Control
• Consequence: AR NM_000044.6 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 0.337
• Publications: 10 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Laboratory for Molecular Medicine, G2P, Labcorp Genetics (formerly Invitae)
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, G2P, Labcorp Genetics (formerly Invitae), Orphanet
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -13 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6
• BP6: Variant X-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCA is Benign according to our data. Variant chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCA is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 422605.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAd4 at 2 XL gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000044.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AR	NM_000044.6	MANE Select	c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	NP_000035.2
	AR	NM_001348063.1		c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80dup	disruptive_inframe_insertion	Exon 1 of 4	NP_001334992.1	Q9NUA2
	AR	NM_001348061.1		c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80dup	disruptive_inframe_insertion	Exon 1 of 4	NP_001334990.1	Q9NUA2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AR	ENST00000374690.9	TSL:1 MANE Select	c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	ENSP00000363822.3	P10275-1
	AR	ENST00000396044.8	TSL:1	c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80dup	disruptive_inframe_insertion	Exon 1 of 5	ENSP00000379359.3	F5GZG9
	AR	ENST00000504326.5	TSL:1	c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80dup	disruptive_inframe_insertion	Exon 1 of 4	ENSP00000421155.1	P10275-3

Frequencies

GnomAD3 genomes AF: 0.00179 AC: 119 AN: 66636 Hom.: 2 Cov.: 0

Gnomad AFR AF: 0.000852

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00306

Gnomad ASJ AF: 0.00408

Gnomad EAS AF: 0.00486

Gnomad SAS AF: 0.00110

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00190

Gnomad OTH AF: 0.00499

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000674 AC: 631 AN: 936887 Hom.: 0 Cov.: 40 AF XY: 0.000142 AC XY: 42 AN XY: 295033

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000463 AC: 11 AN: 23756

American (AMR) AF: 0.00120 AC: 31 AN: 25839

Ashkenazi Jewish (ASJ) AF: 0.00301 AC: 49 AN: 16255

East Asian (EAS) AF: 0.00332 AC: 94 AN: 28322

South Asian (SAS) AF: 0.000819 AC: 37 AN: 45195

European-Finnish (FIN) AF: 0.000580 AC: 21 AN: 36183

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2595

European-Non Finnish (NFE) AF: 0.000472 AC: 339 AN: 718874

Other (OTH) AF: 0.00123 AC: 49 AN: 39868

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00179 AC: 119 AN: 66623 Hom.: 2 Cov.: 0 AF XY: 0.000605 AC XY: 5 AN XY: 8259

African (AFR) AF: 0.000851 AC: 16 AN: 18799

American (AMR) AF: 0.00306 AC: 16 AN: 5236

Ashkenazi Jewish (ASJ) AF: 0.00408 AC: 7 AN: 1715

East Asian (EAS) AF: 0.00488 AC: 9 AN: 1843

South Asian (SAS) AF: 0.00111 AC: 1 AN: 901

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 2025

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 133

European-Non Finnish (NFE) AF: 0.00190 AC: 66 AN: 34713

Other (OTH) AF: 0.00493 AC: 4 AN: 812

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	Androgen resistance syndrome;C0268301:Partial androgen insensitivity syndrome;C0376358:Prostate cancer;C1839259:Kennedy disease;C2678098:Hypospadias 1, X-linked (1)
-	-	1	Androgen resistance syndrome;C1839259:Kennedy disease (1)
-	-	1	Inborn genetic diseases (1)
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.34
Mutation Taster		=69/31	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;