X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCA-T
Variant summary
Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3BP6_Very_StrongBS1BS2
The NM_000044.6(AR):c.216_239delGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln73_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00229 in 1,003,104 control chromosomes in the GnomAD database, including 19 homozygotes. There are 468 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_000044.6 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- androgen insensitivity syndromeInheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
- Kennedy diseaseInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- partial androgen insensitivity syndromeInheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
- complete androgen insensitivity syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -17 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| AR | NM_000044.6 | c.216_239delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln73_Gln80del | disruptive_inframe_deletion | Exon 1 of 8 | ENST00000374690.9 | NP_000035.2 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0122 AC: 813AN: 66623Hom.: 15 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.00159 AC: 1489AN: 936494Hom.: 4 AF XY: 0.00113 AC XY: 334AN XY: 294584 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0122 AC: 812AN: 66610Hom.: 15 Cov.: 0 AF XY: 0.0162 AC XY: 134AN XY: 8252 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Benign:2
AR: BS1, BS2 -
- -
Androgen resistance syndrome;C1839259:Kennedy disease Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at