X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T

Variant names:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T
• rs3032358
• NM_000044.6:c.198_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP6 BS2

The NM_000044.6(AR):​c.198_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln67_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000233 in 1,003,939 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 80 hemizygotes in GnomAD. Variant has been reported in ClinVar as Benign (no stars).

• Frequency:
  • Genomes: 𝑓 0.00074 (0 hom., 11 hem., cov: 0)
  • Exomes 𝑓: 0.00020 (0 hom. 69 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Benign no assertion criteria provided B:1
• Conservation: PhyloP100: 1.40

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP6: Variant X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T is Benign according to our data. Variant chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T is described in ClinVar as [Benign]. Clinvar id is 3053691.Status of the report is no_assertion_criteria_provided, 0 stars.
• BS2: High Hemizygotes in GnomAd4 at 11 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.198_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln67_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.198_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln67_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.000735 AC: 49 AN: 66636 Hom.: 0 Cov.: 0 AF XY: 0.00133 AC XY: 11 AN XY: 8246

Gnomad AFR AF: 0.000213

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000191

Gnomad ASJ AF: 0.00292

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000494

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00104

Gnomad OTH AF: 0.00249

GnomAD4 exome AF: 0.000197 AC: 185 AN: 937316 Hom.: 0 AF XY: 0.000234 AC XY: 69 AN XY: 295406

Gnomad4 AFR exome AF: 0.000168

Gnomad4 AMR exome AF: 0.0000387

Gnomad4 ASJ exome AF: 0.00117

Gnomad4 EAS exome AF: 0.0000352

Gnomad4 SAS exome AF: 0.0000663

Gnomad4 FIN exome AF: 0.000111

Gnomad4 NFE exome AF: 0.000193

Gnomad4 OTH exome AF: 0.000351

GnomAD4 genome AF: 0.000735 AC: 49 AN: 66623 Hom.: 0 Cov.: 0 AF XY: 0.00133 AC XY: 11 AN XY: 8259

Gnomad4 AFR AF: 0.000213

Gnomad4 AMR AF: 0.000191

Gnomad4 ASJ AF: 0.00292

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000494

Gnomad4 NFE AF: 0.00104

Gnomad4 OTH AF: 0.00246

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: no assertion criteria provided

Submissions by phenotype

AR-related disorder Benign:1

Sep 17, 2019

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;