X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCA-T
• rs3032358
• NM_000044.6:c.219_239delGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3 BP6_Very_Strong BS1 BS2

The NM_000044.6(AR):​c.219_239delGCAGCAGCAGCAGCAGCAGCA​(p.Gln74_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00215 in 1,002,829 control chromosomes in the GnomAD database, including 11 homozygotes. There are 336 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.011 (8 hom., 100 hem., cov: 0)
  • Exomes 𝑓: 0.0015 (3 hom. 236 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 1.40
• Publications: 10 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Laboratory for Molecular Medicine, G2P
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics, G2P
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -17 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6
• BP6: Variant X-67545316-TGCAGCAGCAGCAGCAGCAGCA-T is Benign according to our data. Variant chrX-67545316-TGCAGCAGCAGCAGCAGCAGCA-T is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 434262.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population afr. GnomAd4 allele frequency = 0.0113 (754/66602) while in subpopulation AFR AF = 0.0251 (472/18788). AF 95% confidence interval is 0.0233. There are 8 homozygotes in GnomAd4. There are 100 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 8 XL gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000044.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AR	NM_000044.6	MANE Select	c.219_239delGCAGCAGCAGCAGCAGCAGCA	p.Gln74_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	NP_000035.2
	AR	NM_001348063.1		c.219_239delGCAGCAGCAGCAGCAGCAGCA	p.Gln74_Gln80del	disruptive_inframe_deletion	Exon 1 of 4	NP_001334992.1	Q9NUA2
	AR	NM_001348061.1		c.219_239delGCAGCAGCAGCAGCAGCAGCA	p.Gln74_Gln80del	disruptive_inframe_deletion	Exon 1 of 4	NP_001334990.1	Q9NUA2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AR	ENST00000374690.9	TSL:1 MANE Select	c.219_239delGCAGCAGCAGCAGCAGCAGCA	p.Gln74_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENSP00000363822.3	P10275-1
	AR	ENST00000396044.8	TSL:1	c.219_239delGCAGCAGCAGCAGCAGCAGCA	p.Gln74_Gln80del	disruptive_inframe_deletion	Exon 1 of 5	ENSP00000379359.3	F5GZG9
	AR	ENST00000504326.5	TSL:1	c.219_239delGCAGCAGCAGCAGCAGCAGCA	p.Gln74_Gln80del	disruptive_inframe_deletion	Exon 1 of 4	ENSP00000421155.1	P10275-3

Frequencies

GnomAD3 genomes AF: 0.0113 AC: 751 AN: 66615 Hom.: 8 Cov.: 0

Gnomad AFR AF: 0.0250

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0109

Gnomad ASJ AF: 0.00233

Gnomad EAS AF: 0.0184

Gnomad SAS AF: 0.0121

Gnomad FIN AF: 0.00198

Gnomad MID AF: 0.00654

Gnomad NFE AF: 0.00475

Gnomad OTH AF: 0.00748

GnomAD4 exome AF: 0.00149 AC: 1398 AN: 936227 Hom.: 3 AF XY: 0.000802 AC XY: 236 AN XY: 294343

African (AFR) AF: 0.00888 AC: 210 AN: 23660

American (AMR) AF: 0.00244 AC: 63 AN: 25803

Ashkenazi Jewish (ASJ) AF: 0.000677 AC: 11 AN: 16246

East Asian (EAS) AF: 0.00466 AC: 132 AN: 28324

South Asian (SAS) AF: 0.00253 AC: 114 AN: 45067

European-Finnish (FIN) AF: 0.00119 AC: 43 AN: 36138

Middle Eastern (MID) AF: 0.00386 AC: 10 AN: 2589

European-Non Finnish (NFE) AF: 0.00101 AC: 726 AN: 718563

Other (OTH) AF: 0.00223 AC: 89 AN: 39837

GnomAD4 genome AF: 0.0113 AC: 754 AN: 66602 Hom.: 8 Cov.: 0 AF XY: 0.0121 AC XY: 100 AN XY: 8250

African (AFR) AF: 0.0251 AC: 472 AN: 18788

American (AMR) AF: 0.0109 AC: 57 AN: 5236

Ashkenazi Jewish (ASJ) AF: 0.00233 AC: 4 AN: 1714

East Asian (EAS) AF: 0.0185 AC: 34 AN: 1839

South Asian (SAS) AF: 0.0122 AC: 11 AN: 901

European-Finnish (FIN) AF: 0.00198 AC: 4 AN: 2025

Middle Eastern (MID) AF: 0.00752 AC: 1 AN: 133

European-Non Finnish (NFE) AF: 0.00475 AC: 165 AN: 34708

Other (OTH) AF: 0.00739 AC: 6 AN: 812

Alfa AF: 0.00 Hom.: 237

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	Androgen resistance syndrome;C1839259:Kennedy disease (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=187/13	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs3032358;

hg19: chrX-66765158;