X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3BP6_Very_StrongBA1
The NM_000044.6(AR):c.228_239delGCAGCAGCAGCA(p.Gln77_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0208 in 990,164 control chromosomes in the GnomAD database, including 391 homozygotes. There are 2,387 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).
Frequency
Consequence
NM_000044.6 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- androgen insensitivity syndromeInheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Laboratory for Molecular Medicine, G2P, Labcorp Genetics (formerly Invitae)
- Kennedy diseaseInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, G2P, Labcorp Genetics (formerly Invitae), Orphanet
- partial androgen insensitivity syndromeInheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- complete androgen insensitivity syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -17 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000044.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AR | MANE Select | c.228_239delGCAGCAGCAGCA | p.Gln77_Gln80del | disruptive_inframe_deletion | Exon 1 of 8 | NP_000035.2 | |||
| AR | c.228_239delGCAGCAGCAGCA | p.Gln77_Gln80del | disruptive_inframe_deletion | Exon 1 of 4 | NP_001334992.1 | Q9NUA2 | |||
| AR | c.228_239delGCAGCAGCAGCA | p.Gln77_Gln80del | disruptive_inframe_deletion | Exon 1 of 4 | NP_001334990.1 | Q9NUA2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AR | TSL:1 MANE Select | c.228_239delGCAGCAGCAGCA | p.Gln77_Gln80del | disruptive_inframe_deletion | Exon 1 of 8 | ENSP00000363822.3 | P10275-1 | ||
| AR | TSL:1 | c.228_239delGCAGCAGCAGCA | p.Gln77_Gln80del | disruptive_inframe_deletion | Exon 1 of 5 | ENSP00000379359.3 | F5GZG9 | ||
| AR | TSL:1 | c.228_239delGCAGCAGCAGCA | p.Gln77_Gln80del | disruptive_inframe_deletion | Exon 1 of 4 | ENSP00000421155.1 | P10275-3 |
Frequencies
GnomAD3 genomes AF: 0.0913 AC: 6077AN: 66568Hom.: 305 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0157 AC: 14496AN: 923610Hom.: 86 AF XY: 0.00621 AC XY: 1758AN XY: 282944 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0913 AC: 6077AN: 66554Hom.: 305 Cov.: 0 AF XY: 0.0764 AC XY: 629AN XY: 8230 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at