X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-TGCAGCAGCAGCA-T
• rs3032358
• NM_000044.6:c.228_239delGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3 BP6_Very_Strong BA1

The NM_000044.6(AR):​c.228_239delGCAGCAGCAGCA​(p.Gln77_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0208 in 990,164 control chromosomes in the GnomAD database, including 391 homozygotes. There are 2,387 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.091 (305 hom., 629 hem., cov: 0)
  • Exomes 𝑓: 0.016 (86 hom. 1758 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:6
• Conservation: PhyloP100: 1.40
• Publications: 10 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Laboratory for Molecular Medicine, G2P, Labcorp Genetics (formerly Invitae)
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, G2P, Labcorp Genetics (formerly Invitae), Orphanet
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -17 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6
• BP6: Variant X-67545316-TGCAGCAGCAGCA-T is Benign according to our data. Variant chrX-67545316-TGCAGCAGCAGCA-T is described in ClinVar as Benign. ClinVar VariationId is 464796.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.156 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000044.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AR	NM_000044.6	MANE Select	c.228_239delGCAGCAGCAGCA	p.Gln77_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	NP_000035.2
	AR	NM_001348063.1		c.228_239delGCAGCAGCAGCA	p.Gln77_Gln80del	disruptive_inframe_deletion	Exon 1 of 4	NP_001334992.1	Q9NUA2
	AR	NM_001348061.1		c.228_239delGCAGCAGCAGCA	p.Gln77_Gln80del	disruptive_inframe_deletion	Exon 1 of 4	NP_001334990.1	Q9NUA2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AR	ENST00000374690.9	TSL:1 MANE Select	c.228_239delGCAGCAGCAGCA	p.Gln77_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENSP00000363822.3	P10275-1
	AR	ENST00000396044.8	TSL:1	c.228_239delGCAGCAGCAGCA	p.Gln77_Gln80del	disruptive_inframe_deletion	Exon 1 of 5	ENSP00000379359.3	F5GZG9
	AR	ENST00000504326.5	TSL:1	c.228_239delGCAGCAGCAGCA	p.Gln77_Gln80del	disruptive_inframe_deletion	Exon 1 of 4	ENSP00000421155.1	P10275-3

Frequencies

GnomAD3 genomes AF: 0.0913 AC: 6077 AN: 66568 Hom.: 305 Cov.: 0

Gnomad AFR AF: 0.161

Gnomad AMI AF: 0.165

Gnomad AMR AF: 0.0618

Gnomad ASJ AF: 0.0531

Gnomad EAS AF: 0.0286

Gnomad SAS AF: 0.0560

Gnomad FIN AF: 0.0588

Gnomad MID AF: 0.0523

Gnomad NFE AF: 0.0661

Gnomad OTH AF: 0.0599

GnomAD4 exome AF: 0.0157 AC: 14496 AN: 923610 Hom.: 86 AF XY: 0.00621 AC XY: 1758 AN XY: 282944

African (AFR) AF: 0.0489 AC: 1134 AN: 23198

American (AMR) AF: 0.0207 AC: 529 AN: 25521

Ashkenazi Jewish (ASJ) AF: 0.0217 AC: 344 AN: 15882

East Asian (EAS) AF: 0.0146 AC: 409 AN: 27990

South Asian (SAS) AF: 0.00998 AC: 438 AN: 43873

European-Finnish (FIN) AF: 0.0425 AC: 1507 AN: 35443

Middle Eastern (MID) AF: 0.0198 AC: 50 AN: 2522

European-Non Finnish (NFE) AF: 0.0130 AC: 9198 AN: 709979

Other (OTH) AF: 0.0226 AC: 887 AN: 39202

GnomAD4 genome AF: 0.0913 AC: 6077 AN: 66554 Hom.: 305 Cov.: 0 AF XY: 0.0764 AC XY: 629 AN XY: 8230

African (AFR) AF: 0.161 AC: 3016 AN: 18766

American (AMR) AF: 0.0617 AC: 323 AN: 5232

Ashkenazi Jewish (ASJ) AF: 0.0531 AC: 91 AN: 1713

East Asian (EAS) AF: 0.0288 AC: 53 AN: 1842

South Asian (SAS) AF: 0.0556 AC: 50 AN: 900

European-Finnish (FIN) AF: 0.0588 AC: 119 AN: 2024

Middle Eastern (MID) AF: 0.0602 AC: 8 AN: 133

European-Non Finnish (NFE) AF: 0.0661 AC: 2294 AN: 34689

Other (OTH) AF: 0.0616 AC: 50 AN: 812

Alfa AF: 0.0538 Hom.: 237

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	3	not specified (3)
-	-	1	Androgen resistance syndrome;C1839259:Kennedy disease (1)
-	-	1	Kennedy disease (1)
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=200/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158; COSMIC: COSV65960938;