X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-TGCAGCA-T
• rs3032358
• NM_000044.6:c.234_239delGCAGCA

Variant summary

Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3 BP6_Very_Strong BA1

The NM_000044.6(AR):​c.234_239delGCAGCA​(p.Gln79_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0357 in 972,753 control chromosomes in the GnomAD database, including 578 homozygotes. There are 3,759 hemizygotes in GnomAD. Variant has been reported in ClinVar as Benign (★★). Synonymous variant affecting the same amino acid position (i.e. Q78Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.11 (412 hom., 660 hem., cov: 0)
  • Exomes 𝑓: 0.031 (166 hom. 3099 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:6
• Conservation: PhyloP100: 1.40
• Publications: 10 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -17 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6
• BP6: Variant X-67545316-TGCAGCA-T is Benign according to our data. Variant chrX-67545316-TGCAGCA-T is described in ClinVar as Benign. ClinVar VariationId is 1276845.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.125 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.234_239delGCAGCA	p.Gln79_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.234_239delGCAGCA	p.Gln79_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.106 AC: 7056 AN: 66528 Hom.: 415 Cov.: 0

Gnomad AFR AF: 0.0781

Gnomad AMI AF: 0.0987

Gnomad AMR AF: 0.0722

Gnomad ASJ AF: 0.0981

Gnomad EAS AF: 0.0686

Gnomad SAS AF: 0.125

Gnomad FIN AF: 0.110

Gnomad MID AF: 0.157

Gnomad NFE AF: 0.128

Gnomad OTH AF: 0.0900

GnomAD4 exome AF: 0.0305 AC: 27642 AN: 906238 Hom.: 166 AF XY: 0.0115 AC XY: 3099 AN XY: 268732

African (AFR) AF: 0.0310 AC: 720 AN: 23254

American (AMR) AF: 0.0249 AC: 625 AN: 25077

Ashkenazi Jewish (ASJ) AF: 0.0443 AC: 692 AN: 15632

East Asian (EAS) AF: 0.0413 AC: 1116 AN: 27015

South Asian (SAS) AF: 0.0356 AC: 1478 AN: 41505

European-Finnish (FIN) AF: 0.0934 AC: 3167 AN: 33917

Middle Eastern (MID) AF: 0.0389 AC: 96 AN: 2469

European-Non Finnish (NFE) AF: 0.0260 AC: 18154 AN: 699052

Other (OTH) AF: 0.0416 AC: 1594 AN: 38317

GnomAD4 genome AF: 0.106 AC: 7049 AN: 66515 Hom.: 412 Cov.: 0 AF XY: 0.0802 AC XY: 660 AN XY: 8229

African (AFR) AF: 0.0780 AC: 1465 AN: 18774

American (AMR) AF: 0.0723 AC: 378 AN: 5227

Ashkenazi Jewish (ASJ) AF: 0.0981 AC: 168 AN: 1713

East Asian (EAS) AF: 0.0684 AC: 126 AN: 1841

South Asian (SAS) AF: 0.124 AC: 112 AN: 901

European-Finnish (FIN) AF: 0.110 AC: 221 AN: 2014

Middle Eastern (MID) AF: 0.158 AC: 21 AN: 133

European-Non Finnish (NFE) AF: 0.128 AC: 4442 AN: 34656

Other (OTH) AF: 0.0889 AC: 72 AN: 810

Alfa AF: 0.0586 Hom.: 237

ClinVar

Significance: Benign

Submissions summary: Benign:6

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:2

Feb 16, 2025

Laboratory of Genetics, Children's Clinical University Hospital Latvia

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

-

Genome Diagnostics Laboratory, University Medical Center Utrecht

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

not provided Benign:2

Sep 16, 2019

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

-

Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Androgen resistance syndrome;C1839259:Kennedy disease Benign:1

Aug 29, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Kennedy disease Benign:1

Apr 24, 2023

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=200/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158; COSMIC: COSV65952724;