X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-TGCA-T
• rs3032358
• NM_000044.6:c.237_239delGCA

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BA1

The NM_000044.6(AR):​c.237_239delGCA​(p.Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0492 in 981,829 control chromosomes in the GnomAD database, including 1,031 homozygotes. There are 4,595 hemizygotes in GnomAD. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.15 (753 hom., 775 hem., cov: 0)
  • Exomes 𝑓: 0.042 (278 hom. 3820 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: 1.40

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant X-67545316-TGCA-T is Benign according to our data. Variant chrX-67545316-TGCA-T is described in ClinVar as [Benign]. Clinvar id is 464798.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-67545316-TGCA-T is described in Lovd as [Benign]. Variant chrX-67545316-TGCA-T is described in Lovd as [Benign].
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.179 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.237_239delGCA	p.Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.237_239delGCA	p.Gln80del	disruptive_inframe_deletion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.153 AC: 10163 AN: 66458 Hom.: 753 Cov.: 0 AF XY: 0.0942 AC XY: 775 AN XY: 8228

Gnomad AFR AF: 0.110

Gnomad AMI AF: 0.110

Gnomad AMR AF: 0.145

Gnomad ASJ AF: 0.117

Gnomad EAS AF: 0.114

Gnomad SAS AF: 0.101

Gnomad FIN AF: 0.159

Gnomad MID AF: 0.144

Gnomad NFE AF: 0.183

Gnomad OTH AF: 0.163

GnomAD4 exome AF: 0.0417 AC: 38184 AN: 915384 Hom.: 278 AF XY: 0.0139 AC XY: 3820 AN XY: 274494

Gnomad4 AFR exome AF: 0.0376

Gnomad4 AMR exome AF: 0.0519

Gnomad4 ASJ exome AF: 0.0484

Gnomad4 EAS exome AF: 0.0844

Gnomad4 SAS exome AF: 0.0296

Gnomad4 FIN exome AF: 0.120

Gnomad4 NFE exome AF: 0.0356

Gnomad4 OTH exome AF: 0.0575

GnomAD4 genome AF: 0.153 AC: 10160 AN: 66445 Hom.: 753 Cov.: 0 AF XY: 0.0940 AC XY: 775 AN XY: 8241

Gnomad4 AFR AF: 0.109

Gnomad4 AMR AF: 0.145

Gnomad4 ASJ AF: 0.117

Gnomad4 EAS AF: 0.115

Gnomad4 SAS AF: 0.101

Gnomad4 FIN AF: 0.159

Gnomad4 NFE AF: 0.183

Gnomad4 OTH AF: 0.161

ClinVar

Significance: Benign

Submissions summary: Benign:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:2

-

Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

-

Genome Diagnostics Laboratory, University Medical Center Utrecht

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Androgen resistance syndrome;C1839259:Kennedy disease Benign:1

Jan 08, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Benign:1

Mar 03, 2015

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is associated with the following publications: (PMID: 26398403) -

Androgen resistance syndrome;C0268301:Partial androgen insensitivity syndrome;C0376358:Malignant tumor of prostate;C1839259:Kennedy disease;C2678098:Hypospadias 1, X-linked Benign:1

May 04, 2022

Fulgent Genetics, Fulgent Genetics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Name	Calibrated prediction	Score	Prediction
SpliceAI score (max)		0.0		Details are displayed if max score is > 0.2

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;