X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3BP6_Very_StrongBA1
The NM_000044.6(AR):c.231_239dupGCAGCAGCA(p.Gln78_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0236 in 988,999 control chromosomes in the GnomAD database, including 363 homozygotes. There are 1,465 hemizygotes in GnomAD. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. Q80Q) has been classified as Likely benign.
Frequency
Consequence
NM_000044.6 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- androgen insensitivity syndromeInheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
- Kennedy diseaseInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- partial androgen insensitivity syndromeInheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
- complete androgen insensitivity syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -17 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| AR | NM_000044.6 | c.231_239dupGCAGCAGCA | p.Gln78_Gln80dup | disruptive_inframe_insertion | Exon 1 of 8 | ENST00000374690.9 | NP_000035.2 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0635 AC: 4232AN: 66600Hom.: 213 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0207 AC: 19133AN: 922412Hom.: 152 Cov.: 40 AF XY: 0.00408 AC XY: 1146AN XY: 281002 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0635 AC: 4227AN: 66587Hom.: 211 Cov.: 0 AF XY: 0.0387 AC XY: 319AN XY: 8253 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Benign:3
- -
- -
- -
not specified Benign:2
- -
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at