X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-T-TGCAGCAGCAGCA
• rs3032358
• NM_000044.6:c.228_239dupGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3 BP6_Very_Strong BS1 BS2

The NM_000044.6(AR):​c.228_239dupGCAGCAGCAGCA​(p.Gln77_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0135 in 995,294 control chromosomes in the GnomAD database, including 87 homozygotes. There are 759 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. Q80Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.035 (73 hom., 161 hem., cov: 0)
  • Exomes 𝑓: 0.012 (14 hom. 598 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 0.337
• Publications: 10 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -17 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6
• BP6: Variant X-67545316-T-TGCAGCAGCAGCA is Benign according to our data. Variant chrX-67545316-T-TGCAGCAGCAGCA is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 1168151.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population eas. GnomAd4 allele frequency = 0.035 (2331/66600) while in subpopulation EAS AF = 0.0582 (107/1840). AF 95% confidence interval is 0.0492. There are 73 homozygotes in GnomAd4. There are 161 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 73 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.228_239dupGCAGCAGCAGCA	p.Gln77_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.228_239dupGCAGCAGCAGCA	p.Gln77_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.0350 AC: 2332 AN: 66613 Hom.: 72 Cov.: 0

Gnomad AFR AF: 0.0195

Gnomad AMI AF: 0.00897

Gnomad AMR AF: 0.0402

Gnomad ASJ AF: 0.0321

Gnomad EAS AF: 0.0584

Gnomad SAS AF: 0.0318

Gnomad FIN AF: 0.0469

Gnomad MID AF: 0.0261

Gnomad NFE AF: 0.0412

Gnomad OTH AF: 0.0374

GnomAD4 exome AF: 0.0119 AC: 11056 AN: 928694 Hom.: 14 Cov.: 40 AF XY: 0.00208 AC XY: 598 AN XY: 287162

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00634 AC: 150 AN: 23673

American (AMR) AF: 0.0231 AC: 588 AN: 25476

Ashkenazi Jewish (ASJ) AF: 0.0184 AC: 296 AN: 16044

East Asian (EAS) AF: 0.0411 AC: 1135 AN: 27601

South Asian (SAS) AF: 0.0150 AC: 657 AN: 43753

European-Finnish (FIN) AF: 0.0394 AC: 1398 AN: 35494

Middle Eastern (MID) AF: 0.0148 AC: 38 AN: 2563

European-Non Finnish (NFE) AF: 0.00868 AC: 6204 AN: 714645

Other (OTH) AF: 0.0150 AC: 590 AN: 39445

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0350 AC: 2331 AN: 66600 Hom.: 73 Cov.: 0 AF XY: 0.0195 AC XY: 161 AN XY: 8246

African (AFR) AF: 0.0195 AC: 367 AN: 18793

American (AMR) AF: 0.0403 AC: 211 AN: 5233

Ashkenazi Jewish (ASJ) AF: 0.0321 AC: 55 AN: 1715

East Asian (EAS) AF: 0.0582 AC: 107 AN: 1840

South Asian (SAS) AF: 0.0333 AC: 30 AN: 901

European-Finnish (FIN) AF: 0.0469 AC: 95 AN: 2024

Middle Eastern (MID) AF: 0.0226 AC: 3 AN: 133

European-Non Finnish (NFE) AF: 0.0412 AC: 1429 AN: 34703

Other (OTH) AF: 0.0369 AC: 30 AN: 812

Alfa AF: 0.00 Hom.: 237

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

Feb 16, 2025

Laboratory of Genetics, Children's Clinical University Hospital Latvia

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Androgen resistance syndrome;C1839259:Kennedy disease Benign:1

Jan 27, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Benign:1

Apr 09, 2015

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

AR-related disorder Benign:1

Mar 17, 2020

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.34
Mutation Taster		=69/31	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;