X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-T-TGCAGCAGCAGCAGCAGCA
• rs3032358
• NM_000044.6:c.222_239dupGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3 BP6_Very_Strong BS1 BS2

The NM_000044.6(AR):​c.222_239dupGCAGCAGCAGCAGCAGCA​(p.Gln75_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. Q80Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.011 (13 hom., 54 hem., cov: 0)
  • Exomes 𝑓: 0.0039 (6 hom. 321 hem.)
  • Failed GnomAD Quality Control
• Consequence: AR NM_000044.6 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: 0.337
• Publications: 10 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -17 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6
• BP6: Variant X-67545316-T-TGCAGCAGCAGCAGCAGCA is Benign according to our data. Variant chrX-67545316-T-TGCAGCAGCAGCAGCAGCA is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 1285161.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population eas. GnomAd4 allele frequency = 0.0111 (738/66617) while in subpopulation EAS AF = 0.0206 (38/1843). AF 95% confidence interval is 0.0154. There are 13 homozygotes in GnomAd4. There are 54 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 13 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.222_239dupGCAGCAGCAGCAGCAGCA	p.Gln75_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.222_239dupGCAGCAGCAGCAGCAGCA	p.Gln75_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.0111 AC: 738 AN: 66630 Hom.: 13 Cov.: 0

Gnomad AFR AF: 0.00618

Gnomad AMI AF: 0.00448

Gnomad AMR AF: 0.0130

Gnomad ASJ AF: 0.0134

Gnomad EAS AF: 0.0200

Gnomad SAS AF: 0.0110

Gnomad FIN AF: 0.00840

Gnomad MID AF: 0.0196

Gnomad NFE AF: 0.0130

Gnomad OTH AF: 0.0125

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00387 AC: 3620 AN: 934384 Hom.: 6 Cov.: 40 AF XY: 0.00110 AC XY: 321 AN XY: 292684

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00194 AC: 46 AN: 23730

American (AMR) AF: 0.00848 AC: 218 AN: 25716

Ashkenazi Jewish (ASJ) AF: 0.00526 AC: 85 AN: 16167

East Asian (EAS) AF: 0.0137 AC: 385 AN: 28124

South Asian (SAS) AF: 0.00341 AC: 153 AN: 44847

European-Finnish (FIN) AF: 0.00920 AC: 331 AN: 35987

Middle Eastern (MID) AF: 0.00232 AC: 6 AN: 2587

European-Non Finnish (NFE) AF: 0.00306 AC: 2197 AN: 717482

Other (OTH) AF: 0.00501 AC: 199 AN: 39744

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0111 AC: 738 AN: 66617 Hom.: 13 Cov.: 0 AF XY: 0.00654 AC XY: 54 AN XY: 8257

African (AFR) AF: 0.00617 AC: 116 AN: 18799

American (AMR) AF: 0.0130 AC: 68 AN: 5236

Ashkenazi Jewish (ASJ) AF: 0.0134 AC: 23 AN: 1715

East Asian (EAS) AF: 0.0206 AC: 38 AN: 1843

South Asian (SAS) AF: 0.00999 AC: 9 AN: 901

European-Finnish (FIN) AF: 0.00840 AC: 17 AN: 2023

Middle Eastern (MID) AF: 0.0226 AC: 3 AN: 133

European-Non Finnish (NFE) AF: 0.0130 AC: 452 AN: 34709

Other (OTH) AF: 0.0123 AC: 10 AN: 812

Alfa AF: 0.00 Hom.: 237

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:3

-

Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

-

Genome Diagnostics Laboratory, University Medical Center Utrecht

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Feb 16, 2025

Laboratory of Genetics, Children's Clinical University Hospital Latvia

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Benign:1

Nov 01, 2023

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

AR-related disorder Benign:1

Jan 05, 2021

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.34
Mutation Taster		=69/31	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;