X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCA
• rs3032358
• NM_000044.6:c.219_239dupGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3 BP6_Very_Strong BS1 BS2

The NM_000044.6(AR):​c.219_239dupGCAGCAGCAGCAGCAGCAGCA​(p.Gln74_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. Q80Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0072 (6 hom., 24 hem., cov: 0)
  • Exomes 𝑓: 0.0026 (4 hom. 137 hem.)
  • Failed GnomAD Quality Control
• Consequence: AR NM_000044.6 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 0.337
• Publications: 10 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -17 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6
• BP6: Variant X-67545316-T-TGCAGCAGCAGCAGCAGCAGCA is Benign according to our data. Variant chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCA is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 507868.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.00716 (477/66618) while in subpopulation SAS AF = 0.0111 (10/901). AF 95% confidence interval is 0.00817. There are 6 homozygotes in GnomAd4. There are 24 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 6 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.219_239dupGCAGCAGCAGCAGCAGCAGCA	p.Gln74_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.219_239dupGCAGCAGCAGCAGCAGCAGCA	p.Gln74_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.00717 AC: 478 AN: 66631 Hom.: 6 Cov.: 0

Gnomad AFR AF: 0.00309

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00765

Gnomad ASJ AF: 0.0111

Gnomad EAS AF: 0.0103

Gnomad SAS AF: 0.0110

Gnomad FIN AF: 0.00543

Gnomad MID AF: 0.00654

Gnomad NFE AF: 0.00902

Gnomad OTH AF: 0.00873

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00257 AC: 2403 AN: 935489 Hom.: 4 Cov.: 40 AF XY: 0.000466 AC XY: 137 AN XY: 293801

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000969 AC: 23 AN: 23747

American (AMR) AF: 0.00512 AC: 132 AN: 25777

Ashkenazi Jewish (ASJ) AF: 0.00353 AC: 57 AN: 16160

East Asian (EAS) AF: 0.00652 AC: 184 AN: 28237

South Asian (SAS) AF: 0.00269 AC: 121 AN: 44961

European-Finnish (FIN) AF: 0.00670 AC: 242 AN: 36094

Middle Eastern (MID) AF: 0.000771 AC: 2 AN: 2593

European-Non Finnish (NFE) AF: 0.00208 AC: 1491 AN: 718106

Other (OTH) AF: 0.00379 AC: 151 AN: 39814

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00716 AC: 477 AN: 66618 Hom.: 6 Cov.: 0 AF XY: 0.00291 AC XY: 24 AN XY: 8258

African (AFR) AF: 0.00309 AC: 58 AN: 18798

American (AMR) AF: 0.00745 AC: 39 AN: 5236

Ashkenazi Jewish (ASJ) AF: 0.0111 AC: 19 AN: 1715

East Asian (EAS) AF: 0.0103 AC: 19 AN: 1843

South Asian (SAS) AF: 0.0111 AC: 10 AN: 901

European-Finnish (FIN) AF: 0.00543 AC: 11 AN: 2025

Middle Eastern (MID) AF: 0.00752 AC: 1 AN: 133

European-Non Finnish (NFE) AF: 0.00899 AC: 312 AN: 34709

Other (OTH) AF: 0.00985 AC: 8 AN: 812

Alfa AF: 0.00 Hom.: 237

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Jul 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

AR: BS2 -

Apr 05, 2021

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Androgen resistance syndrome;C1839259:Kennedy disease Benign:1

Jan 23, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

AR-related disorder Benign:1

May 07, 2019

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.34
Mutation Taster		=69/31	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;