X-67546514-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC

Position:

• chrX-67546514-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_000044.6(AR):​c.1406_1420dupGCGGCGGCGGCGGCG​(p.Gly469_Gly473dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0013 (1 hom., 9 hem., cov: 0)
  • Exomes 𝑓: 0.00021 (0 hom. 33 hem.)
  • Failed GnomAD Quality Control
• Consequence: AR NM_000044.6 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.29

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High Hemizygotes in GnomAd4 at 9 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AR	NM_000044.6	c.1406_1420dupGCGGCGGCGGCGGCG	p.Gly469_Gly473dup	disruptive_inframe_insertion	1/8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.1406_1420dupGCGGCGGCGGCGGCG	p.Gly469_Gly473dup	disruptive_inframe_insertion	1/8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.00126 AC: 105 AN: 83058 Hom.: 1 Cov.: 0 AF XY: 0.000541 AC XY: 9 AN XY: 16622

Gnomad AFR AF: 0.00379

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000897

Gnomad ASJ AF: 0.000450

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000655

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000325

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000206 AC: 98 AN: 476289 Hom.: 0 Cov.: 25 AF XY: 0.000279 AC XY: 33 AN XY: 118279

Gnomad4 AFR exome AF: 0.000908

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000204

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000201

Gnomad4 OTH exome AF: 0.000388

GnomAD4 genome AF: 0.00126 AC: 105 AN: 83062 Hom.: 1 Cov.: 0 AF XY: 0.000541 AC XY: 9 AN XY: 16632

Gnomad4 AFR AF: 0.00379

Gnomad4 AMR AF: 0.000895

Gnomad4 ASJ AF: 0.000450

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000657

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000325

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs746853821; hg19: chrX-66766356;