X-67546514-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC

Variant names:

• chrX-67546514-T-TGGCGGCGGCGGCGGCGGC
• rs746853821
• NM_000044.6:c.1403_1420dupGCGGCGGCGGCGGCGGCG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_000044.6(AR):​c.1403_1420dupGCGGCGGCGGCGGCGGCG​(p.Gly468_Gly473dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency:
  • Genomes: 𝑓 0.0011 (2 hom., 11 hem., cov: 0)
  • Exomes 𝑓: 0.000031 (0 hom. 8 hem.)
  • Failed GnomAD Quality Control
• Consequence: AR NM_000044.6 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 1.29

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High Homozygotes in GnomAd4 at 2 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.1403_1420dupGCGGCGGCGGCGGCGGCG	p.Gly468_Gly473dup	disruptive_inframe_insertion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.1403_1420dupGCGGCGGCGGCGGCGGCG	p.Gly468_Gly473dup	disruptive_inframe_insertion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.00106 AC: 88 AN: 83056 Hom.: 2 Cov.: 0 AF XY: 0.000662 AC XY: 11 AN XY: 16622

Gnomad AFR AF: 0.00194

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00102

Gnomad ASJ AF: 0.000450

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00131

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000788

Gnomad OTH AF: 0.000943

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000315 AC: 15 AN: 476300 Hom.: 0 Cov.: 25 AF XY: 0.0000676 AC XY: 8 AN XY: 118280

Gnomad4 AFR exome AF: 0.0000756

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000679

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000349

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00106 AC: 88 AN: 83060 Hom.: 2 Cov.: 0 AF XY: 0.000661 AC XY: 11 AN XY: 16632

Gnomad4 AFR AF: 0.00194

Gnomad4 AMR AF: 0.00102

Gnomad4 ASJ AF: 0.000450

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00131

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000788

Gnomad4 OTH AF: 0.000929

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

AR-related disorder Uncertain:1

May 02, 2024

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

The AR c.1403_1420dup18 variant is predicted to result in an in-frame duplication (p.Gly468_Gly473dup). To our knowledge, this variant has not been reported in the literature or in a large population database. However, the allele frequency of variant in gnomAD is not reliable due to the repetitive nature of the affected region. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs746853821; hg19: chrX-66766356;