X-67546514-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC

Variant names:

• chrX-67546514-T-TGGCGGCGGCGGCGGCGGCGGC
• rs746853821
• NM_000044.6:c.1400_1420dupGCGGCGGCGGCGGCGGCGGCG

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_000044.6(AR):​c.1400_1420dupGCGGCGGCGGCGGCGGCGGCG​(p.Gly467_Gly473dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000217 in 83,062 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 1 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. E474E) has been classified as Likely benign.

• Frequency: Genomes: 𝑓 0.00022 (0 hom., 1 hem., cov: 0)
• Consequence: AR NM_000044.6 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.29
• Publications: 6 publications found

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR Gene-Disease associations (from GenCC):

• androgen insensitivity syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Laboratory for Molecular Medicine, G2P, Labcorp Genetics (formerly Invitae)
• Kennedy disease

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, G2P, Labcorp Genetics (formerly Invitae), Orphanet
• partial androgen insensitivity syndrome

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• complete androgen insensitivity syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000044.6

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000044.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AR	NM_000044.6	MANE Select	c.1400_1420dupGCGGCGGCGGCGGCGGCGGCG	p.Gly467_Gly473dup	disruptive_inframe_insertion	Exon 1 of 8	NP_000035.2
	AR	NM_001348063.1		c.1400_1420dupGCGGCGGCGGCGGCGGCGGCG	p.Gly467_Gly473dup	disruptive_inframe_insertion	Exon 1 of 4	NP_001334992.1	Q9NUA2
	AR	NM_001348061.1		c.1400_1420dupGCGGCGGCGGCGGCGGCGGCG	p.Gly467_Gly473dup	disruptive_inframe_insertion	Exon 1 of 4	NP_001334990.1	Q9NUA2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AR	ENST00000374690.9	TSL:1 MANE Select	c.1400_1420dupGCGGCGGCGGCGGCGGCGGCG	p.Gly467_Gly473dup	disruptive_inframe_insertion	Exon 1 of 8	ENSP00000363822.3	P10275-1
	AR	ENST00000396044.8	TSL:1	c.1400_1420dupGCGGCGGCGGCGGCGGCGGCG	p.Gly467_Gly473dup	disruptive_inframe_insertion	Exon 1 of 5	ENSP00000379359.3	F5GZG9
	AR	ENST00000504326.5	TSL:1	c.1400_1420dupGCGGCGGCGGCGGCGGCGGCG	p.Gly467_Gly473dup	disruptive_inframe_insertion	Exon 1 of 4	ENSP00000421155.1	P10275-3

Frequencies

GnomAD3 genomes AF: 0.000217 AC: 18 AN: 83058 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000277

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.000450

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000255

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 25

GnomAD4 genome AF: 0.000217 AC: 18 AN: 83062 Hom.: 0 Cov.: 0 AF XY: 0.0000601 AC XY: 1 AN XY: 16632

African (AFR) AF: 0.000277 AC: 6 AN: 21655

American (AMR) AF: 0.00 AC: 0 AN: 7817

Ashkenazi Jewish (ASJ) AF: 0.000450 AC: 1 AN: 2222

East Asian (EAS) AF: 0.00 AC: 0 AN: 2564

South Asian (SAS) AF: 0.00 AC: 0 AN: 1522

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 2382

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 174

European-Non Finnish (NFE) AF: 0.000255 AC: 11 AN: 43137

Other (OTH) AF: 0.00 AC: 0 AN: 1076

Alfa AF: 0.00 Hom.: 327

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3
Mutation Taster		=78/22	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs746853821; hg19: chrX-66766356;