X-67546514-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC

Position:

• chrX-67546514-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000044.6(AR):​c.1385_1420dup​(p.Gly462_Gly473dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000361 in 83,062 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. G456G) has been classified as Likely benign.

• Frequency: Genomes: 𝑓 0.000036 (0 hom., 0 hem., cov: 0)
• Consequence: AR NM_000044.6 inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.29

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
AR	NM_000044.6	c.1385_1420dup	p.Gly462_Gly473dup	inframe_insertion	1/8	ENST00000374690.9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
AR	ENST00000374690.9	c.1385_1420dup	p.Gly462_Gly473dup	inframe_insertion	1/8	1	NM_000044.6	P1

Frequencies

GnomAD3 genomes AF: 0.0000361 AC: 3 AN: 83058 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 16622

Gnomad AFR AF: 0.0000924

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000128

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 25

GnomAD4 genome AF: 0.0000361 AC: 3 AN: 83062 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 16632

Gnomad4 AFR AF: 0.0000924

Gnomad4 AMR AF: 0.000128

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs746853821; hg19: chrX-66766356;