X-70027876-TGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCA-T

Variant summary

Our verdict is Pathogenic. The variant received 11 ACMG points: 11P and 0B. PM4PP3PP5_Very_Strong

The NM_001399.5(EDA):​c.553_588delAATGGCCCTCCAGGACCCCCAGGACCTCCAGGACCC​(p.Asn185_Pro196del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

Frequency

Genomes: not found (cov: 21)

Consequence

EDA
NM_001399.5 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:5

Conservation

PhyloP100: 8.96

Publications

3 publications found
Variant links:
Genes affected
EDA (HGNC:3157): (ectodysplasin A) The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
EDA Gene-Disease associations (from GenCC):
  • tooth agenesis, selective, X-linked, 1
    Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
  • X-linked hypohidrotic ectodermal dysplasia
    Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae)
  • tooth agenesis
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 11 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_001399.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant X-70027876-TGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCA-T is Pathogenic according to our data. Variant chrX-70027876-TGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCA-T is described in ClinVar as Pathogenic. ClinVar VariationId is 44198.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
EDANM_001399.5 linkc.553_588delAATGGCCCTCCAGGACCCCCAGGACCTCCAGGACCC p.Asn185_Pro196del conservative_inframe_deletion Exon 4 of 8 ENST00000374552.9 NP_001390.1 Q92838-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
EDAENST00000374552.9 linkc.553_588delAATGGCCCTCCAGGACCCCCAGGACCTCCAGGACCC p.Asn185_Pro196del conservative_inframe_deletion Exon 4 of 8 1 NM_001399.5 ENSP00000363680.4 Q92838-1

Frequencies

GnomAD3 genomes
Cov.:
21
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
21

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:5
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Hypohidrotic X-linked ectodermal dysplasia Pathogenic:3
May 02, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant, c.553_588del, results in the deletion of 12 amino acid(s) of the EDA protein (p.Asn185_Pro196del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with hypohidrotic ectodermal dysplasia (PMID: 9683615, 9736768, 18231121). In at least one individual the variant was observed to be de novo. This variant is also known as Del794–829 or 789/795del36. ClinVar contains an entry for this variant (Variation ID: 44198). For these reasons, this variant has been classified as Pathogenic. -

Oct 31, 2013
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The p.Asn185_Pro196del variant in EDA has been identified in several individuals with clinical features of X-linked hypohidrotic ectodermal dysplasia (Bayes 199 8, Monreal 1998, Schneider 2001, Lexner 2008, Schneider 2011). Some of these ind ividuals were reported to have the c.553_588del variant, as seen in this individ ual, while others were reported to have the c.546_581del variant. Both variants result in the same amino acid deletion, and therefore likely have the same impac t to the protein. Non-standard nomenclature has been also used in some reports ( c.del794-829). The variant has been identified in one carrier mother and her two affected sons, as well as de novo in at least 2 individuals with de novo diseas e (Monreal 1998, Scheinder 2001). In summary, this variant meets our criteria to be classified as pathogenic for HED in an X-linked manner (http://www.partners. org/personalizedmedicine/LMM). -

Dec 18, 2024
Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

not provided Pathogenic:2
Dec 17, 2022
Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Oct 14, 2022
GeneDx
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

In-frame deletion of 12 amino acids in a non-repeat region predicted to critically alter the protein; Not observed at significant frequency in large population cohorts (gnomAD); In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 11279189, 31796081, 18510547, 9736768, 21357618, 9683615) -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.0
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs397516666; hg19: chrX-69247726; API