rs397516666

Variant names:

• chrX-70027876-TGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCA-T
• rs397516666
• NM_001399.5:c.553_588delAATGGCCCTCCAGGACCCCCAGGACCTCCAGGACCC

Variant summary

Our verdict is Pathogenic. Variant got 13 ACMG points: 13P and 0B. PM2 PM4 PP3 PP5_Very_Strong

The NM_001399.5(EDA):​c.553_588delAATGGCCCTCCAGGACCCCCAGGACCTCCAGGACCC​(p.Asn185_Pro196del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 21)
• Consequence: EDA NM_001399.5 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 8.96

Genes affected

EDA (HGNC:3157): (ectodysplasin A) The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 13 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001399.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-70027876-TGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCA-T is Pathogenic according to our data. Variant chrX-70027876-TGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCA-T is described in ClinVar as [Pathogenic]. Clinvar id is 44198.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-70027876-TGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCA-T is described in Lovd as [Pathogenic]. Variant chrX-70027876-TGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCA-T is described in Lovd as [Pathogenic]. Variant chrX-70027876-TGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCA-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EDA	NM_001399.5	c.553_588delAATGGCCCTCCAGGACCCCCAGGACCTCCAGGACCC	p.Asn185_Pro196del	conservative_inframe_deletion	Exon 4 of 8	ENST00000374552.9	NP_001390.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EDA	ENST00000374552.9	c.553_588delAATGGCCCTCCAGGACCCCCAGGACCTCCAGGACCC	p.Asn185_Pro196del	conservative_inframe_deletion	Exon 4 of 8	1	NM_001399.5	ENSP00000363680.4

Frequencies

GnomAD3 genomes Cov.: 21

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 21

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hypohidrotic X-linked ectodermal dysplasia Pathogenic:3

Dec 18, 2024

Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 02, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.553_588del, results in the deletion of 12 amino acid(s) of the EDA protein (p.Asn185_Pro196del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with hypohidrotic ectodermal dysplasia (PMID: 9683615, 9736768, 18231121). In at least one individual the variant was observed to be de novo. This variant is also known as Del794–829 or 789/795del36. ClinVar contains an entry for this variant (Variation ID: 44198). For these reasons, this variant has been classified as Pathogenic. -

Oct 31, 2013

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The p.Asn185_Pro196del variant in EDA has been identified in several individuals with clinical features of X-linked hypohidrotic ectodermal dysplasia (Bayes 199 8, Monreal 1998, Schneider 2001, Lexner 2008, Schneider 2011). Some of these ind ividuals were reported to have the c.553_588del variant, as seen in this individ ual, while others were reported to have the c.546_581del variant. Both variants result in the same amino acid deletion, and therefore likely have the same impac t to the protein. Non-standard nomenclature has been also used in some reports ( c.del794-829). The variant has been identified in one carrier mother and her two affected sons, as well as de novo in at least 2 individuals with de novo diseas e (Monreal 1998, Scheinder 2001). In summary, this variant meets our criteria to be classified as pathogenic for HED in an X-linked manner (http://www.partners. org/personalizedmedicine/LMM). -

not provided Pathogenic:2

Dec 17, 2022

Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Oct 14, 2022

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame deletion of 12 amino acids in a non-repeat region predicted to critically alter the protein; Not observed at significant frequency in large population cohorts (gnomAD); In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 11279189, 31796081, 18510547, 9736768, 21357618, 9683615) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397516666; hg19: chrX-69247726;