X-71366335-G-GCTGCTGCGGACAGCAGCTACCATCA

Variant names:

• chrX-71366335-G-GCTGCTGCGGACAGCAGCTACCATCA
• rs753316021
• ENST00000423759:c.-32_-8dupGGACAGCAGCTACCATCACTGCTGC

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The ENST00000423759(TAF1):​c.-32_-8dupGGACAGCAGCTACCATCACTGCTGC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000364 in 1,097,605 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 11 hemizygotes in GnomAD. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.000064 (0 hom., 1 hem., cov: 20)
  • Exomes 𝑓: 0.000036 (0 hom. 11 hem.)
  • Failed GnomAD Quality Control
• Consequence: TAF1 ENST00000423759 5_prime_UTR
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.00

Genes affected

TAF1 (HGNC:11535): (TATA-box binding protein associated factor 1) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is the basal transcription factor TFIID, which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes the largest subunit of TFIID. This subunit binds to core promoter sequences encompassing the transcription start site. It also binds to activators and other transcriptional regulators, and these interactions affect the rate of transcription initiation. This subunit contains two independent protein kinase domains at the N- and C-terminals, but also possesses acetyltransferase activity and can act as a ubiquitin-activating/conjugating enzyme. Mutations in this gene result in Dystonia 3, torsion, X-linked, a dystonia-parkinsonism disorder. Alternative splicing of this gene results in multiple transcript variants. This gene is part of a complex transcription unit (TAF1/DYT3), wherein some transcript variants share exons with TAF1 as well as additional downstream DYT3 exons. [provided by RefSeq, Oct 2013]

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• BP6: Variant X-71366335-G-GCTGCTGCGGACAGCAGCTACCATCA is Benign according to our data. Variant chrX-71366335-G-GCTGCTGCGGACAGCAGCTACCATCA is described in ClinVar as [Benign]. Clinvar id is 2908086.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Hemizygotes in GnomAdExome4 at 11 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TAF1	NM_004606.5	c.-40_-39insCTGCTGCGGACAGCAGCTACCATCA		upstream_gene_variant		ENST00000423759.6	NP_004597.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TAF1	ENST00000423759	c.-32_-8dupGGACAGCAGCTACCATCACTGCTGC		5_prime_UTR_variant	Exon 1 of 38	5	NM_004606.5	ENSP00000406549.2
TAF1	ENST00000423759.6	c.-40_-39insCTGCTGCGGACAGCAGCTACCATCA		upstream_gene_variant		5	NM_004606.5	ENSP00000406549.2

Frequencies

GnomAD3 genomes AF: 0.0000640 AC: 7 AN: 109446 Hom.: 0 Cov.: 20 AF XY: 0.0000316 AC XY: 1 AN XY: 31672

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00174

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000190

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000873 AC: 16 AN: 183259 Hom.: 0 AF XY: 0.0000295 AC XY: 2 AN XY: 67835

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.000535

Gnomad EAS exome AF: 0.000794

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000122

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000364 AC: 40 AN: 1097605 Hom.: 0 Cov.: 33 AF XY: 0.0000303 AC XY: 11 AN XY: 363249

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.000464

Gnomad4 EAS exome AF: 0.000364

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000214

Gnomad4 OTH exome AF: 0.0000434

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000639 AC: 7 AN: 109494 Hom.: 0 Cov.: 20 AF XY: 0.0000315 AC XY: 1 AN XY: 31730

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00174

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000190

Gnomad4 OTH AF: 0.00

Alfa AF: 0.0000868 Hom.: 0

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Mar 17, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs753316021; hg19: chrX-70586185;