chrX-71366335-G-GCTGCTGCGGACAGCAGCTACCATCA

Variant names:

• chrX-71366335-G-GCTGCTGCGGACAGCAGCTACCATCA
• rs753316021
• ENST00000423759.6:c.-32_-8dupGGACAGCAGCTACCATCACTGCTGC

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The ENST00000423759.6(TAF1):​c.-32_-8dupGGACAGCAGCTACCATCACTGCTGC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000364 in 1,097,605 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 11 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.000064 (0 hom., 1 hem., cov: 20)
  • Exomes 𝑓: 0.000036 (0 hom. 11 hem.)
  • Failed GnomAD Quality Control
• Consequence: TAF1 ENST00000423759.6 5_prime_UTR
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.00
• Publications: 1 publications found

Genes affected

TAF1 (HGNC:11535): (TATA-box binding protein associated factor 1) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is the basal transcription factor TFIID, which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes the largest subunit of TFIID. This subunit binds to core promoter sequences encompassing the transcription start site. It also binds to activators and other transcriptional regulators, and these interactions affect the rate of transcription initiation. This subunit contains two independent protein kinase domains at the N- and C-terminals, but also possesses acetyltransferase activity and can act as a ubiquitin-activating/conjugating enzyme. Mutations in this gene result in Dystonia 3, torsion, X-linked, a dystonia-parkinsonism disorder. Alternative splicing of this gene results in multiple transcript variants. This gene is part of a complex transcription unit (TAF1/DYT3), wherein some transcript variants share exons with TAF1 as well as additional downstream DYT3 exons. [provided by RefSeq, Oct 2013]

TAF1 Gene-Disease associations (from GenCC):

• intellectual disability, X-linked, syndromic 33

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Illumina
• X-linked dystonia-parkinsonism

  Inheritance: XL, Unknown Classification: STRONG, MODERATE, SUPPORTIVE, LIMITED Submitted by: Ambry Genetics, Genomics England PanelApp, Orphanet, Labcorp Genetics (formerly Invitae)
• X-linked intellectual disability-global development delay-facial dysmorphism-sacral caudal remnant syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• BP6: Variant X-71366335-G-GCTGCTGCGGACAGCAGCTACCATCA is Benign according to our data. Variant chrX-71366335-G-GCTGCTGCGGACAGCAGCTACCATCA is described in ClinVar as [Benign]. Clinvar id is 2908086.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Hemizygotes in GnomAdExome4 at 11 XL,Unknown gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TAF1	NM_004606.5	c.-40_-39insCTGCTGCGGACAGCAGCTACCATCA		upstream_gene_variant		ENST00000423759.6	NP_004597.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TAF1	ENST00000423759.6	c.-32_-8dupGGACAGCAGCTACCATCACTGCTGC		5_prime_UTR_variant	Exon 1 of 38	5	NM_004606.5	ENSP00000406549.2
TAF1	ENST00000423759.6	c.-40_-39insCTGCTGCGGACAGCAGCTACCATCA		upstream_gene_variant		5	NM_004606.5	ENSP00000406549.2

Frequencies

GnomAD3 genomes AF: 0.0000640 AC: 7 AN: 109446 Hom.: 0 Cov.: 20

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00174

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000190

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000873 AC: 16 AN: 183259 AF XY: 0.0000295

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.000535

Gnomad EAS exome AF: 0.000794

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000122

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000364 AC: 40 AN: 1097605 Hom.: 0 Cov.: 33 AF XY: 0.0000303 AC XY: 11 AN XY: 363249

African (AFR) AF: 0.00 AC: 0 AN: 26374

American (AMR) AF: 0.00 AC: 0 AN: 35200

Ashkenazi Jewish (ASJ) AF: 0.000464 AC: 9 AN: 19385

East Asian (EAS) AF: 0.000364 AC: 11 AN: 30203

South Asian (SAS) AF: 0.00 AC: 0 AN: 54119

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 40532

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3637

European-Non Finnish (NFE) AF: 0.0000214 AC: 18 AN: 842103

Other (OTH) AF: 0.0000434 AC: 2 AN: 46052

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000639 AC: 7 AN: 109494 Hom.: 0 Cov.: 20 AF XY: 0.0000315 AC XY: 1 AN XY: 31730

African (AFR) AF: 0.00 AC: 0 AN: 29952

American (AMR) AF: 0.00 AC: 0 AN: 10179

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2622

East Asian (EAS) AF: 0.00174 AC: 6 AN: 3445

South Asian (SAS) AF: 0.00 AC: 0 AN: 2537

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 5782

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 212

European-Non Finnish (NFE) AF: 0.0000190 AC: 1 AN: 52614

Other (OTH) AF: 0.00 AC: 0 AN: 1476

Alfa AF: 0.0000868 Hom.: 0

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Mar 17, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.0
Mutation Taster		=195/5	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs753316021; hg19: chrX-70586185;