X-78011478-T-TTTTCTGTATTCCTGTAATGGGGCTGATGATA

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000052.7(ATP7A):​c.1978_2008dupTTCTGTATTCCTGTAATGGGGCTGATGATAT​(p.Tyr670fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 22)

Consequence

ATP7A
NM_000052.7 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 0.626
Variant links:
Genes affected
ATP7A (HGNC:869): (ATPase copper transporting alpha) This gene encodes a transmembrane protein that functions in copper transport across membranes. This protein is localized to the trans Golgi network, where it is predicted to supply copper to copper-dependent enzymes in the secretory pathway. It relocalizes to the plasma membrane under conditions of elevated extracellular copper, and functions in the efflux of copper from cells. Mutations in this gene are associated with Menkes disease, X-linked distal spinal muscular atrophy, and occipital horn syndrome. Alternatively-spliced transcript variants have been observed. [provided by RefSeq, Aug 2013]
PGK1 (HGNC:8896): (phosphoglycerate kinase 1) The protein encoded by this gene is a glycolytic enzyme that catalyzes the conversion of 1,3-diphosphoglycerate to 3-phosphoglycerate. The encoded protein may also act as a cofactor for polymerase alpha. Additionally, this protein is secreted by tumor cells where it participates in angiogenesis by functioning to reduce disulfide bonds in the serine protease, plasmin, which consequently leads to the release of the tumor blood vessel inhibitor angiostatin. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Deficiency of the enzyme is associated with a wide range of clinical phenotypes hemolytic anemia and neurological impairment. Pseudogenes of this gene have been defined on chromosomes 19, 21 and the X chromosome. [provided by RefSeq, Jan 2014]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant X-78011478-T-TTTTCTGTATTCCTGTAATGGGGCTGATGATA is Pathogenic according to our data. Variant chrX-78011478-T-TTTTCTGTATTCCTGTAATGGGGCTGATGATA is described in ClinVar as [Pathogenic]. Clinvar id is 210409.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
ATP7ANM_000052.7 linkuse as main transcriptc.1978_2008dupTTCTGTATTCCTGTAATGGGGCTGATGATAT p.Tyr670fs frameshift_variant 9/23 ENST00000341514.11 NP_000043.4 Q04656-1B4DRW0Q762B6
ATP7ANM_001282224.2 linkuse as main transcriptc.1978_2008dupTTCTGTATTCCTGTAATGGGGCTGATGATAT p.Tyr670fs frameshift_variant 9/22 NP_001269153.1 Q04656-5B4DRW0Q762B6
ATP7ANR_104109.2 linkuse as main transcriptn.285-19920_285-19890dupTTCTGTATTCCTGTAATGGGGCTGATGATAT intron_variant

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
ATP7AENST00000341514.11 linkuse as main transcriptc.1978_2008dupTTCTGTATTCCTGTAATGGGGCTGATGATAT p.Tyr670fs frameshift_variant 9/231 NM_000052.7 ENSP00000345728.6 Q04656-1

Frequencies

GnomAD3 genomes
Cov.:
22
GnomAD4 exome
Cov.:
30
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Menkes kinky-hair syndrome Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingGenetic Services Laboratory, University of ChicagoFeb 08, 2013- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs797045343; hg19: chrX-77266975; API