chr1-111414879-CTCACAGACTGATGACTCACAGGGG-C

Position:

• chr1-111414879-CTCACAGACTGATGACTCACAGGGG-C

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 2P and 10B. PM4 BP6_Moderate BA1

The NM_002557.4(OVGP1):​c.1598_1621delCCCCTGTGAGTCATCAGTCTGTGA​(p.Thr533_Val540del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.32 (7619 hom., cov: 0)
  • Exomes 𝑓: 0.32 (74902 hom.)
  • Failed GnomAD Quality Control
• Consequence: OVGP1 NM_002557.4 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.31

Genes affected

OVGP1 (HGNC:8524): (oviductal glycoprotein 1) This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]

LOC124904309 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_002557.4.
• BP6: Variant 1-111414879-CTCACAGACTGATGACTCACAGGGG-C is Benign according to our data. Variant chr1-111414879-CTCACAGACTGATGACTCACAGGGG-C is described in ClinVar as [Benign]. Clinvar id is 767686.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.359 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
OVGP1	NM_002557.4	c.1598_1621delCCCCTGTGAGTCATCAGTCTGTGA	p.Thr533_Val540del	disruptive_inframe_deletion	11/11	ENST00000369732.4	NP_002548.3
LOC124904309	XR_007066387.1	n.84_91+16delTCACAGGGGTCACAGACTGATGAC		splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	1/2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
OVGP1	ENST00000369732.4	c.1598_1621delCCCCTGTGAGTCATCAGTCTGTGA	p.Thr533_Val540del	disruptive_inframe_deletion	11/11	1	NM_002557.4	ENSP00000358747.3

Frequencies

GnomAD3 genomes AF: 0.319 AC: 47164 AN: 147836 Hom.: 7610 Cov.: 0

Gnomad AFR AF: 0.364

Gnomad AMI AF: 0.301

Gnomad AMR AF: 0.238

Gnomad ASJ AF: 0.213

Gnomad EAS AF: 0.205

Gnomad SAS AF: 0.314

Gnomad FIN AF: 0.337

Gnomad MID AF: 0.260

Gnomad NFE AF: 0.325

Gnomad OTH AF: 0.284

GnomAD3 exomes AF: 0.286 AC: 70893 AN: 247672 Hom.: 11175 AF XY: 0.287 AC XY: 38399 AN XY: 133764

Gnomad AFR exome AF: 0.334

Gnomad AMR exome AF: 0.214

Gnomad ASJ exome AF: 0.182

Gnomad EAS exome AF: 0.193

Gnomad SAS exome AF: 0.311

Gnomad FIN exome AF: 0.326

Gnomad NFE exome AF: 0.312

Gnomad OTH exome AF: 0.279

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.316 AC: 454479 AN: 1438230 Hom.: 74902 AF XY: 0.317 AC XY: 226152 AN XY: 713870

Gnomad4 AFR exome AF: 0.361

Gnomad4 AMR exome AF: 0.215

Gnomad4 ASJ exome AF: 0.199

Gnomad4 EAS exome AF: 0.203

Gnomad4 SAS exome AF: 0.326

Gnomad4 FIN exome AF: 0.339

Gnomad4 NFE exome AF: 0.325

Gnomad4 OTH exome AF: 0.297

GnomAD4 genome AF: 0.319 AC: 47210 AN: 147924 Hom.: 7619 Cov.: 0 AF XY: 0.319 AC XY: 23047 AN XY: 72328

Gnomad4 AFR AF: 0.364

Gnomad4 AMR AF: 0.238

Gnomad4 ASJ AF: 0.213

Gnomad4 EAS AF: 0.207

Gnomad4 SAS AF: 0.314

Gnomad4 FIN AF: 0.337

Gnomad4 NFE AF: 0.325

Gnomad4 OTH AF: 0.284

Alfa AF: 0.151 Hom.: 426

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Oct 11, 2019

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs201350653; hg19: chr1-111957501;