chr1-172659335-CACCACCACCACCGCCACCGCCACCACT-C

Variant names:

• chr1-172659335-CACCACCACCACCGCCACCGCCACCACT-C
• rs755648147
• NM_000639.3:c.141_167delACCACCGCCACCGCCACCACTACCACC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_000639.3(FASLG):​c.141_167delACCACCGCCACCGCCACCACTACCACC​(p.Pro48_Pro56del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000754 in 1,459,070 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000075 (0 hom.)
• Consequence: FASLG NM_000639.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 2.98
• Publications: 0 publications found

Genes affected

FASLG (HGNC:11936): (Fas ligand) This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]

FASLG Gene-Disease associations (from GenCC):

• autoimmune lymphoproliferative syndrome type 1

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
• autoimmune lymphoproliferative syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000639.3

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000639.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FASLG	NM_000639.3	MANE Select	c.141_167delACCACCGCCACCGCCACCACTACCACC	p.Pro48_Pro56del	disruptive_inframe_deletion	Exon 1 of 4	NP_000630.1	P48023-1
	FASLG	NM_001302746.2		c.141_167delACCACCGCCACCGCCACCACTACCACC	p.Pro48_Pro56del	disruptive_inframe_deletion	Exon 1 of 3	NP_001289675.1	P48023-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FASLG	ENST00000367721.3	TSL:1 MANE Select	c.141_167delACCACCGCCACCGCCACCACTACCACC	p.Pro48_Pro56del	disruptive_inframe_deletion	Exon 1 of 4	ENSP00000356694.2	P48023-1
	FASLG	ENST00000340030.4	TSL:1	c.141_167delACCACCGCCACCGCCACCACTACCACC	p.Pro48_Pro56del	disruptive_inframe_deletion	Exon 1 of 3	ENSP00000344739.3	P48023-2
	FASLG	ENST00000875216.1		c.141_167delACCACCGCCACCGCCACCACTACCACC	p.Pro48_Pro56del	disruptive_inframe_deletion	Exon 1 of 4	ENSP00000545275.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000812 AC: 2 AN: 246314 AF XY: 0.00000749

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000180

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000754 AC: 11 AN: 1459070 Hom.: 0 AF XY: 0.00000413 AC XY: 3 AN XY: 725686

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33460

American (AMR) AF: 0.00 AC: 0 AN: 44556

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26092

East Asian (EAS) AF: 0.00 AC: 0 AN: 39636

South Asian (SAS) AF: 0.00 AC: 0 AN: 85834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52608

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5688

European-Non Finnish (NFE) AF: 0.00000990 AC: 11 AN: 1110972

Other (OTH) AF: 0.00 AC: 0 AN: 60224

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000108276), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	1	-	FASLG-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs755648147; hg19: chr1-172628475;