chr1-209432291-T-TAGCAGCAGCAGCAGCAGCAGCAGC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The ENST00000366437.8(MIR205HG):n.656_679dupGCAGCAGCAGCAGCAGCAGCAGCA variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000366437.8 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000366437.8. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MIR205HG | NR_145433.1 | n.602_625dupGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon | Exon 3 of 3 | |||||
| MIR205HG | NR_145434.1 | n.737_760dupGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon | Exon 5 of 5 | |||||
| MIR205HG | NR_145435.1 | n.685_708dupGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon | Exon 4 of 4 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MIR205HG | ENST00000366437.8 | TSL:3 | n.656_679dupGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon | Exon 4 of 4 | ||||
| MIR205HG | ENST00000429156.7 | TSL:3 | n.767_790dupGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon | Exon 5 of 5 | ||||
| MIR205HG | ENST00000431096.7 | TSL:3 | n.688_711dupGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon | Exon 4 of 4 |
Frequencies
GnomAD3 genomes AF: 0.0000201 AC: 3AN: 149472Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000676 AC: 8AN: 1183544Hom.: 0 Cov.: 0 AF XY: 0.00000855 AC XY: 5AN XY: 585120 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000201 AC: 3AN: 149472Hom.: 0 Cov.: 0 AF XY: 0.0000137 AC XY: 1AN XY: 72848 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at