chr1-219928038-GGAAGATGAGCAGCCCCACCACGTTGACCAACAGCCCCAGGACGCCGACGATGAGCACCAGCTCGGGGTCATCGATGCGCTCGGGCCGGGCCAGGCGCAGCACGGCCTCCAC-G

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP3

The NM_018713.3(SLC30A10):​c.292_402del​(p.Val98_Phe134del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000698 in 1,433,684 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

Frequency

Genomes: not found (cov: 32)
Exomes 𝑓: 7.0e-7 ( 0 hom. )

Consequence

SLC30A10
NM_018713.3 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

not provided no classification provided O:1

Conservation

PhyloP100: 8.79

Publications

2 publications found
Variant links:
Genes affected
SLC30A10 (HGNC:25355): (solute carrier family 30 member 10) This gene is highly expressed in the liver and is inducible by manganese. Its protein product appears to be critical in maintaining manganese levels, and has higher specificity for manganese than zinc. Loss of function mutations appear to result in a pleomorphic phenotype, including dystonia and adult-onset parkinsonism. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
SLC30A10 Gene-Disease associations (from GenCC):
  • cirrhosis - dystonia - polycythemia - hypermanganesemia syndrome
    Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_018713.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SLC30A10NM_018713.3 linkc.292_402del p.Val98_Phe134del conservative_inframe_deletion Exon 1 of 4 ENST00000366926.4 NP_061183.2 Q6XR72-4B3KR19
SLC30A10NM_001416005.1 linkc.-422_-312del 5_prime_UTR_variant Exon 1 of 4 NP_001402934.1
SLC30A10NM_001376929.1 linkc.452-1044_452-934del intron_variant Intron 1 of 3 NP_001363858.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SLC30A10ENST00000366926.4 linkc.292_402del p.Val98_Phe134del conservative_inframe_deletion Exon 1 of 4 1 NM_018713.3 ENSP00000355893.4 Q6XR72-4
SLC30A10ENST00000356609.2 linkn.292_402del non_coding_transcript_exon_variant Exon 1 of 4 1 ENSP00000349018.2 Q6XR72-3
SLC30A10ENST00000696608.1 linkc.452-1044_452-934del intron_variant Intron 1 of 3 ENSP00000512752.1 A0A8Q3WLF3
SLC30A10ENST00000484239.5 linkn.81-1044_81-934del intron_variant Intron 1 of 8 2

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
AF:
6.98e-7
AC:
1
AN:
1433684
Hom.:
0
AF XY:
0.00000141
AC XY:
1
AN XY:
710832
show subpopulations
⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
African (AFR)
AF:
0.00
AC:
0
AN:
32360
American (AMR)
AF:
0.00
AC:
0
AN:
41768
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
25630
East Asian (EAS)
AF:
0.00
AC:
0
AN:
37300
South Asian (SAS)
AF:
0.00
AC:
0
AN:
81972
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
49780
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
5742
European-Non Finnish (NFE)
AF:
9.09e-7
AC:
1
AN:
1099848
Other (OTH)
AF:
0.00
AC:
0
AN:
59284
⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.225
Heterozygous variant carriers
0
0
1
1
2
2
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Exome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
GnomAD4 genome
Cov.:
32

ClinVar

Significance: not provided
Submissions summary: Other:1
Revision: no classification provided
LINK: link

Submissions by phenotype

Hypermanganesemia with dystonia, polycythemia, and cirrhosis Other:1
-
GeneReviews
Significance:not provided
Review Status:no classification provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
8.8
Mutation Taster
=7/193
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1553313839; hg19: chr1-220101380; API