chr1-226965322-AATCCCCTGTTGGGGGCCTCAC-TTG

Variant names:

• chr1-226965322-AATCCCCTGTTGGGGGCCTCAC-TTG
• rs606231139
• NM_020247.5:c.500_521delAATCCCCTGTTGGGGGCCTCACinsTTG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_020247.5(COQ8A):​c.500_521delAATCCCCTGTTGGGGGCCTCACinsTTG​(p.Gln167LeufsTer36) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. Q167Q) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: COQ8A NM_020247.5 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 6.02
• Publications: 3 publications found

Genes affected

COQ8A (HGNC:16812): (coenzyme Q8A) This gene encodes a mitochondrial protein similar to yeast ABC1, which functions in an electron-transferring membrane protein complex in the respiratory chain. It is not related to the family of ABC transporter proteins. Expression of this gene is induced by the tumor suppressor p53 and in response to DNA damage, and inhibiting its expression partially suppresses p53-induced apoptosis. Alternatively spliced transcript variants have been found; however, their full-length nature has not been determined. [provided by RefSeq, Jul 2008]

COQ8A Gene-Disease associations (from GenCC):

• autosomal recessive ataxia due to ubiquinone deficiency

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• coenzyme Q10 deficiency

  Inheritance: AR Classification: DEFINITIVE Submitted by: Illumina

ENSG00000288674 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 1-226965322-AATCCCCTGTTGGGGGCCTCAC-TTG is Pathogenic according to our data. Variant chr1-226965322-AATCCCCTGTTGGGGGCCTCAC-TTG is described in ClinVar as Pathogenic. ClinVar VariationId is 3642.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020247.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COQ8A	NM_020247.5	MANE Select	c.500_521delAATCCCCTGTTGGGGGCCTCACinsTTG	p.Gln167LeufsTer36	frameshift missense	Exon 3 of 15	NP_064632.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COQ8A	ENST00000366777.4	TSL:1 MANE Select	c.500_521delAATCCCCTGTTGGGGGCCTCACinsTTG	p.Gln167LeufsTer36	frameshift missense	Exon 3 of 15	ENSP00000355739.3
	COQ8A	ENST00000366778.5	TSL:1	c.344_365delAATCCCCTGTTGGGGGCCTCACinsTTG	p.Gln115LeufsTer36	frameshift missense	Exon 3 of 15	ENSP00000355740.1
	ENSG00000288674	ENST00000366779.6	TSL:2	n.*5227_*5248delAATCCCCTGTTGGGGGCCTCACinsTTG		non_coding_transcript_exon	Exon 20 of 32	ENSP00000355741.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Autosomal recessive ataxia due to ubiquinone deficiency Pathogenic:1

Oct 01, 2010

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

not provided Pathogenic:1

Nov 20, 2017

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.500_521del22insTTG variant in the COQ8A gene has been reported previously as c.500_521delinsTTG in the homozygous state in an individual with childhood-onset cerebellar ataxia and cerebellar atrophy and was shown to result in decreased CoQ10 in fibroblasts, impaired cell growth, and decreased ATP production (Lagier-Tourenne et al., 2008; Quinzii et al., 2010). The c.500_521del22insTTG variant causes a frameshift starting with codon Glutamine 167, changes this amino acid to a Leucine residue, and creates a premature Stop codon at position 36 of the new reading frame, denoted p.Gln167LeufsX36. This variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. The c.500_521del22insTTG variant is not observed in large population cohorts (Lek et al., 2016). We interpret c.500_521del22insTTG as a pathogenic variant.

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs606231139; hg19: chr1-227153023;