chr1-240207641-TCCTCCGCCCCCTCTACCCGGAGCGGCAATACCC-T

Position:

• chr1-240207641-TCCTCCGCCCCCTCTACCCGGAGCGGCAATACCC-T

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 2P and 12B. PM4 BP6_Very_Strong BS1

The NM_020066.5(FMN2):​c.2844_2876delACCCGGAGCGGCAATACCCCCTCCGCCCCCTCT​(p.Pro949_Leu959del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. L948L) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.0077 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0045 (32 hom.)
  • Failed GnomAD Quality Control
• Consequence: FMN2 NM_020066.5 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 2.82

Genes affected

FMN2 (HGNC:14074): (formin 2) This gene is a member of the formin homology protein family. The encoded protein is thought to have essential roles in organization of the actin cytoskeleton and in cell polarity. This protein mediates the formation of an actin mesh that positions the spindle during oogenesis and also regulates the formation of actin filaments in the nucleus. This protein also forms a perinuclear actin/focal-adhesion system that regulates the shape and position of the nucleus during cell migration. Mutations in this gene have been associated with infertility and also with an autosomal recessive form of intellectual disability (MRT47). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Jul 2017]

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_020066.5.
• BP6: Variant 1-240207641-TCCTCCGCCCCCTCTACCCGGAGCGGCAATACCC-T is Benign according to our data. Variant chr1-240207641-TCCTCCGCCCCCTCTACCCGGAGCGGCAATACCC-T is described in ClinVar as [Likely_benign]. Clinvar id is 446013.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.00774 (358/46266) while in subpopulation AFR AF= 0.0154 (146/9494). AF 95% confidence interval is 0.0133. There are 0 homozygotes in gnomad4. There are 160 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
FMN2	NM_020066.5	c.2844_2876delACCCGGAGCGGCAATACCCCCTCCGCCCCCTCT	p.Pro949_Leu959del	disruptive_inframe_deletion	5/18	ENST00000319653.14	NP_064450.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
FMN2	ENST00000319653.14	c.2844_2876delACCCGGAGCGGCAATACCCCCTCCGCCCCCTCT	p.Pro949_Leu959del	disruptive_inframe_deletion	5/18	5	NM_020066.5	ENSP00000318884.9

Frequencies

GnomAD3 genomes AF: 0.00774 AC: 358 AN: 46244 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0154

Gnomad AMI AF: 0.0510

Gnomad AMR AF: 0.0107

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000312

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00576

Gnomad OTH AF: 0.0100

GnomAD3 exomes AF: 0.00242 AC: 530 AN: 219330 Hom.: 1 AF XY: 0.00235 AC XY: 279 AN XY: 118972

Gnomad AFR exome AF: 0.00535

Gnomad AMR exome AF: 0.00344

Gnomad ASJ exome AF: 0.000120

Gnomad EAS exome AF: 0.000253

Gnomad SAS exome AF: 0.000408

Gnomad FIN exome AF: 0.000206

Gnomad NFE exome AF: 0.00305

Gnomad OTH exome AF: 0.00559

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00445 AC: 3844 AN: 863656 Hom.: 32 AF XY: 0.00430 AC XY: 1833 AN XY: 426264

Gnomad4 AFR exome AF: 0.00843

Gnomad4 AMR exome AF: 0.00505

Gnomad4 ASJ exome AF: 0.000646

Gnomad4 EAS exome AF: 0.000422

Gnomad4 SAS exome AF: 0.000536

Gnomad4 FIN exome AF: 0.000309

Gnomad4 NFE exome AF: 0.00499

Gnomad4 OTH exome AF: 0.00434

GnomAD4 genome AF: 0.00774 AC: 358 AN: 46266 Hom.: 0 Cov.: 0 AF XY: 0.00726 AC XY: 160 AN XY: 22044

Gnomad4 AFR AF: 0.0154

Gnomad4 AMR AF: 0.0107

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000312

Gnomad4 NFE AF: 0.00576

Gnomad4 OTH AF: 0.0100

Alfa AF: 0.000506 Hom.: 0

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Benign, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	Jul 01, 2024	FMN2: BS1, BS2 -
Likely benign, criteria provided, single submitter	clinical testing	Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics	Apr 27, 2017	- -

not specified Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Mar 06, 2024

Variant summary: FMN2 c.2844_2876del33 (p.Ala952_Ala962del) results in an in-frame deletion that is predicted to remove 11 amino acids from Formin, FH2 domain (IPR015425) of the encoded protein. This variant is within a repeat region, consist of GIPLPPPLPGA or GIPPPPPLPGA, and inframe del/dup from this region have not been reported in HGMD. The variant allele was found at a frequency of 0.0024 in 219330 control chromosomes in the gnomAD database, including 1 homozygotes. To our knowledge, no occurrence of c.2844_2876del33 in individuals affected with Intellectual Disability, Autosomal Recessive 47 and no experimental evidence demonstrating its impact on protein function have been reported. ClinVar contains an entry for this variant (Variation ID: 446013). Based on the evidence outlined above, the variant was classified as likely benign. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs758726356; hg19: chr1-240370941;