chr1-2556705-CCACCCCCAAAACCGACGTCT-C

Variant names:

• chr1-2556705-CCACCCCCAAAACCGACGTCT-C
• NM_003820.4:c.42_61delCACCCCCAAAACCGACGTCT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_003820.4(TNFRSF14):​c.42_61delCACCCCCAAAACCGACGTCT​(p.Thr15GlufsTer55) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TNFRSF14 NM_003820.4 frameshift
• Clinical Significance: Other O:1
• Conservation: PhyloP100: -0.0480
• Publications: 0 publications found

Genes affected

TNFRSF14 (HGNC:11912): (TNF receptor superfamily member 14) This gene encodes a member of the TNF (tumor necrosis factor) receptor superfamily. The encoded protein functions in signal transduction pathways that activate inflammatory and inhibitory T-cell immune response. It binds herpes simplex virus (HSV) viral envelope glycoprotein D (gD), mediating its entry into cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

TNFRSF14-AS1 (HGNC:26966): (TNFRSF14 antisense RNA 1)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003820.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TNFRSF14	NM_003820.4	MANE Select	c.42_61delCACCCCCAAAACCGACGTCT	p.Thr15GlufsTer55	frameshift	Exon 1 of 8	NP_003811.2
	TNFRSF14	NM_001297605.2		c.42_61delCACCCCCAAAACCGACGTCT	p.Thr15GlufsTer55	frameshift	Exon 1 of 7	NP_001284534.1
	TNFRSF14-AS1	NR_037844.2		n.36-29_36-10delAGACGTCGGTTTTGGGGGTG		intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TNFRSF14	ENST00000355716.5	TSL:1 MANE Select	c.42_61delCACCCCCAAAACCGACGTCT	p.Thr15GlufsTer55	frameshift	Exon 1 of 8	ENSP00000347948.4	Q92956-1
	TNFRSF14	ENST00000475523.5	TSL:1	n.70+251_70+270delCACCCCCAAAACCGACGTCT		intron	N/A
	TNFRSF14	ENST00000860787.1		c.42_61delCACCCCCAAAACCGACGTCT	p.Thr15GlufsTer55	frameshift	Exon 1 of 8	ENSP00000530846.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Other

Revision:

Pathogenic	VUS	Benign	Condition
-	-	-	Neoplasm (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.048

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr1-2488144;