chr1-26282320-TCCAGGACAGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGA-T

Position:

• chr1-26282320-TCCAGGACAGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGA-T

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 2P and 8B. PM4 BA1

The NM_001389556.1(UBXN11):​c.1464_1541delTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCCTGTCCTGG​(p.Pro489_Gly514del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.117 in 1,031,132 control chromosomes in the GnomAD database, including 17 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.021 (0 hom., cov: 0)
  • Exomes 𝑓: 0.12 (17 hom.)
  • Failed GnomAD Quality Control
• Consequence: UBXN11 NM_001389556.1 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:3
• Conservation: PhyloP100: 1.21

Genes affected

UBXN11 (HGNC:30600): (UBX domain protein 11) This gene encodes a protein with a divergent C-terminal UBX domain. The homologous protein in the rat interacts with members of the Rnd subfamily of Rho GTPases at the cell periphery through its C-terminal region. It also interacts with several heterotrimeric G proteins through their G-alpha subunits and promotes Rho GTPase activation. It is proposed to serve a bidirectional role in the promotion and inhibition of Rho activity through upstream signaling pathways. The 3' coding sequence of this gene contains a polymoprhic region of 24 nt tandem repeats. Several transcripts containing between 1.5 and five repeat units have been reported. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

UBXN11 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001389556.1.
• BA1: GnomAdExome4 highest subpopulation (AMR) allele frequency at 95% confidence interval = 0.185 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
UBXN11	NM_001389556.1	c.1464_1541delTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCCTGTCCTGG	p.Pro489_Gly514del	disruptive_inframe_deletion	15/15	ENST00000374222.6	NP_001376485.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
UBXN11	ENST00000374222.6	c.1464_1541delTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCCTGTCCTGG	p.Pro489_Gly514del	disruptive_inframe_deletion	15/15	5	NM_001389556.1	ENSP00000363339.1

Frequencies

GnomAD3 genomes AF: 0.00 AC: 836 AN: 40336 Hom.: 0 Cov.: 0 FAILED QC

Gnomad AFR AF: 0.0123

Gnomad AMI AF: 0.00952

Gnomad AMR AF: 0.0134

Gnomad ASJ AF: 0.0249

Gnomad EAS AF: 0.00343

Gnomad SAS AF: 0.00409

Gnomad FIN AF: 0.0291

Gnomad MID AF: 0.0333

Gnomad NFE AF: 0.0303

Gnomad OTH AF: 0.0227

GnomAD4 exome AF: 0.117 AC: 120887 AN: 1031132 Hom.: 17 AF XY: 0.125 AC XY: 62790 AN XY: 503740

Gnomad4 AFR exome AF: 0.0988

Gnomad4 AMR exome AF: 0.190

Gnomad4 ASJ exome AF: 0.250

Gnomad4 EAS exome AF: 0.109

Gnomad4 SAS exome AF: 0.125

Gnomad4 FIN exome AF: 0.311

Gnomad4 NFE exome AF: 0.103

Gnomad4 OTH exome AF: 0.153

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0209 AC: 843 AN: 40402 Hom.: 0 Cov.: 0 AF XY: 0.0220 AC XY: 435 AN XY: 19744

Gnomad4 AFR AF: 0.0127

Gnomad4 AMR AF: 0.0134

Gnomad4 ASJ AF: 0.0249

Gnomad4 EAS AF: 0.00343

Gnomad4 SAS AF: 0.00461

Gnomad4 FIN AF: 0.0291

Gnomad4 NFE AF: 0.0303

Gnomad4 OTH AF: 0.0225

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: no assertion criteria provided

Submissions by phenotype

Small cell lung carcinoma Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Lung cancer Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Hepatocellular carcinoma Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2073002071; hg19: chr1-26608811;