chr1-47416265-TCGGCGGCCCCTGCGGTCCCGGAGCCGCGCGGGCAGGGGCTGCCGCAGCCGATGGCGGGGCGCAGCGACATGGATCCGCCCGCCGCGTTCTCTGGCTTCCCTGCCCTGCCAGCGGTCGCGCCGTCGGGGCCGCCGCCGTCGCCGCTCGCAGGAGCCGAGCCAGGGCGGGAGCCAGAGGAGGCGGCGGCTGGCCGCGGAGAGGCGGCCCCCACGCCCGCGCCCGGCCCGGGGCGGCGGCGG-T
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_012186.3(FOXE3):c.-37_202del variant causes a 5 prime UTR truncation, exon loss change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_012186.3 5_prime_UTR_truncation, exon_loss
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_012186.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FOXE3 | NM_012186.3 | MANE Select | c.-37_202del | p.Met1fs | frameshift start_lost | Exon 1 of 1 | NP_036318.1 | Q13461 | |
| FOXE3 | NM_012186.3 | MANE Select | c.-37_202del | 5_prime_UTR_truncation exon_loss | Exon 1 of 1 | NP_036318.1 | Q13461 | ||
| LINC01389 | NR_126355.1 | n.29-6603_29-6365del | intron | N/A |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FOXE3 | ENST00000335071.4 | TSL:6 MANE Select | c.-50_189del | p.Met1fs | frameshift start_lost | Exon 1 of 1 | ENSP00000334472.2 | Q13461 | |
| FOXE3 | ENST00000335071.4 | TSL:6 MANE Select | c.-50_189del | 5_prime_UTR_truncation exon_loss | Exon 1 of 1 | ENSP00000334472.2 | Q13461 | ||
| LINC01389 | ENST00000828805.1 | n.207+16859_207+17097del | intron | N/A |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at