chr1-6470357-T-TGGGGACGGATGGCGTGAACGTAGGG
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BP6_Very_Strong
The NM_020631.6(PLEKHG5):c.1681-27_1681-3dupCCCTACGTTCACGCCATCCGTCCCC variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000229 in 1,613,858 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_020631.6 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- neuromuscular diseaseInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- Charcot-Marie-Tooth disease recessive intermediate CInheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
- neuronopathy, distal hereditary motor, autosomal recessive 4Inheritance: AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_020631.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PLEKHG5 | MANE Select | c.1681-27_1681-3dupCCCTACGTTCACGCCATCCGTCCCC | splice_region intron | N/A | NP_065682.2 | ||||
| PLEKHG5 | c.1888-27_1888-3dupCCCTACGTTCACGCCATCCGTCCCC | splice_region intron | N/A | NP_001252522.1 | A0A804EMX3 | ||||
| PLEKHG5 | c.1792-27_1792-3dupCCCTACGTTCACGCCATCCGTCCCC | splice_region intron | N/A | NP_001036128.2 | O94827-3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PLEKHG5 | TSL:2 MANE Select | c.1681-3_1681-2insCCCTACGTTCACGCCATCCGTCCCC | splice_region intron | N/A | ENSP00000366957.3 | O94827-5 | |||
| PLEKHG5 | TSL:1 | c.1792-3_1792-2insCCCTACGTTCACGCCATCCGTCCCC | splice_region intron | N/A | ENSP00000366961.1 | O94827-3 | |||
| PLEKHG5 | TSL:1 | c.1792-3_1792-2insCCCTACGTTCACGCCATCCGTCCCC | splice_region intron | N/A | ENSP00000383706.4 | O94827-3 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152120Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.0000160 AC: 4AN: 250586 AF XY: 0.0000221 show subpopulations
GnomAD4 exome AF: 0.0000246 AC: 36AN: 1461738Hom.: 0 Cov.: 33 AF XY: 0.0000234 AC XY: 17AN XY: 727158 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152120Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1AN XY: 74332 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.