chr11-134094614-CTTCTCCTGAACCCTCCTTATTCATCATGTTCCACCTTAAATGTCACTTCCTGAGGGAAGCAT-C

Variant names:

• chr11-134094614-CTTCTCCTGAACCCTCCTTATTCATCATGTTCCACCTTAAATGTCACTTCCTGAGGGAAGCAT-C
• NM_032801.5:c.76+25456_76+25517delTTCTCCTGAACCCTCCTTATTCATCATGTTCCACCTTAAATGTCACTTCCTGAGGGAAGCAT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_032801.5(JAM3):​c.76+25456_76+25517delTTCTCCTGAACCCTCCTTATTCATCATGTTCCACCTTAAATGTCACTTCCTGAGGGAAGCAT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 0)
• Consequence: JAM3 NM_032801.5 intron
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 0.349

Genes affected

JAM3 (HGNC:15532): (junctional adhesion molecule 3) Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is localized in the tight junctions between high endothelial cells. Unlike other proteins in this family, the this protein is unable to adhere to leukocyte cell lines and only forms weak homotypic interactions. The encoded protein is a member of the junctional adhesion molecule protein family and acts as a receptor for another member of this family. A mutation in an intron of this gene is associated with hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]

LOC124902797 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
JAM3	NM_032801.5	c.76+25456_76+25517delTTCTCCTGAACCCTCCTTATTCATCATGTTCCACCTTAAATGTCACTTCCTGAGGGAAGCAT		intron_variant	Intron 1 of 8	ENST00000299106.9	NP_116190.3
JAM3	NM_001205329.2	c.76+25456_76+25517delTTCTCCTGAACCCTCCTTATTCATCATGTTCCACCTTAAATGTCACTTCCTGAGGGAAGCAT		intron_variant	Intron 1 of 7		NP_001192258.1
LOC124902797	XR_007062960.1	n.10_71delATGCTTCCCTCAGGAAGTGACATTTAAGGTGGAACATGATGAATAAGGAGGGTTCAGGAGAA		non_coding_transcript_exon_variant	Exon 1 of 2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
JAM3	ENST00000299106.9	c.76+25456_76+25517delTTCTCCTGAACCCTCCTTATTCATCATGTTCCACCTTAAATGTCACTTCCTGAGGGAAGCAT		intron_variant	Intron 1 of 8	1	NM_032801.5	ENSP00000299106.4

Frequencies

GnomAD3 genomes Cov.: 0

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

Schizophrenia Uncertain:1

Nov 11, 2022

Department of Psychiatry, The University of Hong Kong

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: case-control

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.35

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

You must be logged in to view publications. This limit was set because tens of millions (!) of queries from AI bots are generated daily.

Other links and lift over

hg19: chr11-133964509;