chr11-2161313-CAGATGGCTGGGGGCTGAGGCTGCA-C

Variant names:

• chr11-2161313-CAGATGGCTGGGGGCTGAGGCTGCA-C
• rs1135401727
• ENST00000729705.1:n.174+2400_174+2423delAGATGGCTGGGGGCTGAGGCTGCA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000729705.1(ENSG00000295384):​n.174+2400_174+2423delAGATGGCTGGGGGCTGAGGCTGCA variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000211 in 283,842 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 33)
  • Exomes 𝑓: 0.000023 (0 hom.)
• Consequence: ENSG00000295384 ENST00000729705.1 intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2 O:1
• Conservation: PhyloP100: 2.15
• Publications: 0 publications found

Genes affected

ENSG00000295384 (HGNC:):

INS (HGNC:6081): (insulin) This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified, including insulin-dependent diabetes mellitus, permanent neonatal diabetes diabetes mellitus, maturity-onset diabetes of the young type 10 and hyperproinsulinemia. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. [provided by RefSeq, May 2020]

INS-IGF2 (HGNC:33527): (INS-IGF2 readthrough) This locus includes two alternatively spliced read-through transcript variants which align to the INS gene in the 5' region and to the IGF2 gene in the 3' region. One transcript is predicted to encode a protein which shares the N-terminus with the INS protein but has a distinct and longer C-terminus, whereas the other transcript is a candidate for nonsense-mediated decay (NMD). The transcripts are imprinted and are paternally expressed in the limb and eye. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
INS	NM_000207.3	c.-187_-164delTGCAGCCTCAGCCCCCAGCCATCT		upstream_gene_variant		ENST00000381330.5	NP_000198.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
INS	ENST00000381330.5	c.-187_-164delTGCAGCCTCAGCCCCCAGCCATCT		upstream_gene_variant		1	NM_000207.3	ENSP00000370731.5
INS-IGF2	ENST00000397270.1	c.-187_-164delTGCAGCCTCAGCCCCCAGCCATCT		upstream_gene_variant		1		ENSP00000380440.1

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152080 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000228 AC: 3 AN: 131762 Hom.: 0 AF XY: 0.0000452 AC XY: 3 AN XY: 66338

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 5302

American (AMR) AF: 0.00 AC: 0 AN: 5694

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 4790

East Asian (EAS) AF: 0.00 AC: 0 AN: 10758

South Asian (SAS) AF: 0.00 AC: 0 AN: 7998

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6886

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 654

European-Non Finnish (NFE) AF: 0.0000369 AC: 3 AN: 81318

Other (OTH) AF: 0.00 AC: 0 AN: 8362

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00109982), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152080 Hom.: 0 Cov.: 33 AF XY: 0.0000269 AC XY: 2 AN XY: 74280

African (AFR) AF: 0.00 AC: 0 AN: 41412

American (AMR) AF: 0.00 AC: 0 AN: 15280

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5178

South Asian (SAS) AF: 0.00 AC: 0 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10626

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000441 AC: 3 AN: 67970

Other (OTH) AF: 0.00 AC: 0 AN: 2088

Alfa AF: 0.00 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Diabetes mellitus, permanent neonatal 4 Uncertain:2

Jun 08, 2021

HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: research

ACMG codes:PM1, PM2 -

-

Clinical Genomics, Uppaluri K&H Personalized Medicine Clinic

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: research

Potent mutations in the INS gene can cause early onset diabetes mellitus which is insulin dependent. May have poor response to sulfonylureas, mutations in this gene can cause beta cell destruction.However, more evidence is required to confer the association of this particular variant c.-366_343del/ rs1135401727 with Permanent neonatal diabetes mellitus(PNDM). -

Permanent neonatal diabetes mellitus Other:1

-

GeneReviews

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=103/197	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1135401727; hg19: chr11-2182543;