chr11-61392606-TGCTCCGGGAGCCGCTGTGGCAGCGTATGCTGCCACG-T

Variant names:

• chr11-61392606-TGCTCCGGGAGCCGCTGTGGCAGCGTATGCTGCCACG-T
• rs1554972391
• NM_001173990.3:c.-24_12delCTCCGGGAGCCGCTGTGGCAGCGTATGCTGCCACGG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_001173990.3(TMEM216):​c.-24_12delCTCCGGGAGCCGCTGTGGCAGCGTATGCTGCCACGG​(p.Met1_Arg4del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TMEM216 NM_001173990.3 start_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 1.84
• Publications: 0 publications found

Genes affected

TMEM216 (HGNC:25018): (transmembrane protein 216) This locus encodes a transmembrane domain-containing protein. Mutations at this locus have been associated with Meckel-Gruber Syndrome Type 2, and Joubert Syndrome 2, also known as Cerebello-oculorenal Syndrome 2. [provided by RefSeq, Aug 2010]

TMEM216 Gene-Disease associations (from GenCC):

• Joubert syndrome 2

  Inheritance: AR Classification: STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• Joubert syndrome with oculorenal defect

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Meckel syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• orofaciodigital syndrome type 6

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Start lost variant, no new inframe start found.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TMEM216	NM_001173990.3	c.-24_12delCTCCGGGAGCCGCTGTGGCAGCGTATGCTGCCACGG	p.Met1_Arg4del	start_lost, conservative_inframe_deletion	Exon 1 of 5	ENST00000515837.7	NP_001167461.1
TMEM216	NM_001173990.3	c.-24_12delCTCCGGGAGCCGCTGTGGCAGCGTATGCTGCCACGG		5_prime_UTR_variant	Exon 1 of 5	ENST00000515837.7	NP_001167461.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TMEM216	ENST00000515837.7	c.-24_12delCTCCGGGAGCCGCTGTGGCAGCGTATGCTGCCACGG	p.Met1_Arg4del	start_lost, conservative_inframe_deletion	Exon 1 of 5	2	NM_001173990.3	ENSP00000440638.1
TMEM216	ENST00000334888.10	c.-24_12delCTCCGGGAGCCGCTGTGGCAGCGTATGCTGCCACGG	p.Met1_Arg4del	start_lost, conservative_inframe_deletion	Exon 1 of 5	2		ENSP00000334844.5
TMEM216	ENST00000515837.7	c.-24_12delCTCCGGGAGCCGCTGTGGCAGCGTATGCTGCCACGG		5_prime_UTR_variant	Exon 1 of 5	2	NM_001173990.3	ENSP00000440638.1
TMEM216	ENST00000334888.10	c.-24_12delCTCCGGGAGCCGCTGTGGCAGCGTATGCTGCCACGG		5_prime_UTR_variant	Exon 1 of 5	2		ENSP00000334844.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Joubert syndrome Uncertain:1

Jan 27, 2020

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Disruption of the initiator codon has not been reported in the literature in individuals with TMEM216-related conditions. ClinVar contains an entry for this variant (Variation ID: 502365). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This sequence change affects the initiator methionine of the TMEM216 mRNA. The next in-frame methionine is located at codon 8. -

not provided Uncertain:1

Jun 02, 2017

Eurofins Ntd Llc (ga)

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554972391; hg19: chr11-61160078;