chr11-65539084-C-CGGCGGCGCTGGGGAACGCAGGCCCCGTGCG
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_001130144.3(LTBP3):c.3878_3907dupCGCACGGGGCCTGCGTTCCCCAGCGCCGCC(p.Pro1293_Arg1302dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. R1303R) has been classified as Likely benign.
Frequency
Consequence
NM_001130144.3 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- brachyolmia-amelogenesis imperfecta syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
- geleophysic dysplasia 3Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- Acromicric dysplasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- geleophysic dysplasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001130144.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LTBP3 | NM_001130144.3 | MANE Select | c.3878_3907dupCGCACGGGGCCTGCGTTCCCCAGCGCCGCC | p.Pro1293_Arg1302dup | conservative_inframe_insertion | Exon 28 of 28 | NP_001123616.1 | Q9NS15-1 | |
| LTBP3 | NM_021070.4 | c.3737_3766dupCGCACGGGGCCTGCGTTCCCCAGCGCCGCC | p.Pro1246_Arg1255dup | conservative_inframe_insertion | Exon 27 of 27 | NP_066548.2 | Q9NS15-2 | ||
| LTBP3 | NM_001164266.1 | c.3386_3415dupCGCACGGGGCCTGCGTTCCCCAGCGCCGCC | p.Pro1129_Arg1138dup | conservative_inframe_insertion | Exon 27 of 27 | NP_001157738.1 | Q9NS15 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LTBP3 | ENST00000301873.11 | TSL:2 MANE Select | c.3878_3907dupCGCACGGGGCCTGCGTTCCCCAGCGCCGCC | p.Pro1293_Arg1302dup | conservative_inframe_insertion | Exon 28 of 28 | ENSP00000301873.5 | Q9NS15-1 | |
| LTBP3 | ENST00000322147.8 | TSL:1 | c.3737_3766dupCGCACGGGGCCTGCGTTCCCCAGCGCCGCC | p.Pro1246_Arg1255dup | conservative_inframe_insertion | Exon 27 of 27 | ENSP00000326647.4 | Q9NS15-2 | |
| LTBP3 | ENST00000528516.5 | TSL:1 | n.*3382_*3411dupCGCACGGGGCCTGCGTTCCCCAGCGCCGCC | non_coding_transcript_exon | Exon 27 of 27 | ENSP00000432350.1 | E9PRF2 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 31
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at