chr11-68775231-ACTACGGTTGGAAAATTCATCTGTAAGACTTCAAATGTGTTTCCCATCCCAGGTAAGTAACAATGGTTGGATAATCCGGACTTAC-A

Variant names:

• chr11-68775231-ACTACGGTTGGAAAATTCATCTGTAAGACTTCAAATGTGTTTCCCATCCCAGGTAAGTAACAATGGTTGGATAATCCGGACTTAC-A
• rs80356802
• NM_001876.4:c.1575+1_1575+84delGTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_001876.4(CPT1A):​c.1575+1_1575+84delGTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG variant causes a splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CPT1A NM_001876.4 splice_donor, splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.36
• Publications: 0 publications found

Genes affected

CPT1A (HGNC:2328): (carnitine palmitoyltransferase 1A) The mitochondrial oxidation of long-chain fatty acids is initiated by the sequential action of carnitine palmitoyltransferase I (which is located in the outer membrane and is detergent-labile) and carnitine palmitoyltransferase II (which is located in the inner membrane and is detergent-stable), together with a carnitine-acylcarnitine translocase. CPT I is the key enzyme in the carnitine-dependent transport across the mitochondrial inner membrane and its deficiency results in a decreased rate of fatty acid beta-oxidation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

CPT1A Gene-Disease associations (from GenCC):

• carnitine palmitoyl transferase 1A deficiency

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), Orphanet, PanelApp Australia

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.0503876 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CPT1A	NM_001876.4	c.1575+1_1575+84delGTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG		splice_donor_variant, splice_region_variant, intron_variant	Intron 13 of 18	ENST00000265641.10	NP_001867.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CPT1A	ENST00000265641.10	c.1575+1_1575+84delGTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG		splice_donor_variant, splice_region_variant, intron_variant	Intron 13 of 18	1	NM_001876.4	ENSP00000265641.4
CPT1A	ENST00000376618.6	c.1575+1_1575+84delGTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG		splice_donor_variant, splice_region_variant, intron_variant	Intron 13 of 18	1		ENSP00000365803.2
CPT1A	ENST00000540367.5	c.1575+1_1575+84delGTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG		splice_donor_variant, splice_region_variant, intron_variant	Intron 12 of 17	1		ENSP00000439084.1
CPT1A	ENST00000539743.5	c.1575+1_1575+84delGTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG		splice_donor_variant, splice_region_variant, intron_variant	Intron 12 of 17	5		ENSP00000446108.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs80356802; hg19: chr11-68542699;