chr11-694780-C-CGGCCTCGTCGGGGCCGGGCAG

Variant names:

• chr11-694780-C-CGGCCTCGTCGGGGCCGGGCAG
• rs1861033651
• NM_021008.4:c.247_267dupCTGCCCGGCCCCGACGAGGCC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_021008.4(DEAF1):​c.247_267dupCTGCCCGGCCCCGACGAGGCC​(p.Ala89_Ala90insLeuProGlyProAspGluAla) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: DEAF1 NM_021008.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.19

Genes affected

DEAF1 (HGNC:14677): (DEAF1 transcription factor) This gene encodes a zinc finger domain-containing protein that functions as a regulator of transcription. The encoded proteins binds to its own promoter as well as to that of several target genes. Activity of this protein is important in the regulation of embryonic development. Mutations in this gene have been found in individuals with autosomal dominant cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

EPS8L2 (HGNC:21296): (EPS8 signaling adaptor L2) This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_021008.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DEAF1	NM_021008.4	c.247_267dupCTGCCCGGCCCCGACGAGGCC	p.Ala89_Ala90insLeuProGlyProAspGluAla	conservative_inframe_insertion	Exon 1 of 12	ENST00000382409.4	NP_066288.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DEAF1	ENST00000382409.4	c.247_267dupCTGCCCGGCCCCGACGAGGCC	p.Ala89_Ala90insLeuProGlyProAspGluAla	conservative_inframe_insertion	Exon 1 of 12	1	NM_021008.4	ENSP00000371846.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Jul 12, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has not been reported in the literature in individuals affected with DEAF1-related conditions. ClinVar contains an entry for this variant (Variation ID: 1476571). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant is not present in population databases (gnomAD no frequency). This variant, c.247_267dup, results in the insertion of 7 amino acid(s) of the DEAF1 protein (p.Leu83_Ala89dup), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1861033651; hg19: chr11-694780;