chr11-694952-C-CGCGGCCGCGGCCGCCGCCGCCACA
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_021008.4(DEAF1):c.72_95dupTGTGGCGGCGGCGGCCGCGGCCGC(p.Ala32_Ala33insValAlaAlaAlaAlaAlaAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000402 in 149,098 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A32A) has been classified as Likely benign.
Frequency
Consequence
NM_021008.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- hearing loss, autosomal recessive 106Inheritance: AR Classification: STRONG Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae)
- nonsyndromic genetic hearing lossInheritance: AR Classification: MODERATE Submitted by: ClinGen
- hearing loss, autosomal recessiveInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_021008.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DEAF1 | NM_021008.4 | MANE Select | c.72_95dupTGTGGCGGCGGCGGCCGCGGCCGC | p.Ala32_Ala33insValAlaAlaAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 12 | NP_066288.2 | ||
| DEAF1 | NM_001440883.1 | c.72_95dupTGTGGCGGCGGCGGCCGCGGCCGC | p.Ala32_Ala33insValAlaAlaAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 11 | NP_001427812.1 | |||
| DEAF1 | NM_001440884.1 | c.72_95dupTGTGGCGGCGGCGGCCGCGGCCGC | p.Ala32_Ala33insValAlaAlaAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 11 | NP_001427813.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DEAF1 | ENST00000382409.4 | TSL:1 MANE Select | c.72_95dupTGTGGCGGCGGCGGCCGCGGCCGC | p.Ala32_Ala33insValAlaAlaAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 12 | ENSP00000371846.3 | ||
| DEAF1 | ENST00000882097.1 | c.72_95dupTGTGGCGGCGGCGGCCGCGGCCGC | p.Ala32_Ala33insValAlaAlaAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 13 | ENSP00000552156.1 | |||
| DEAF1 | ENST00000917805.1 | c.72_95dupTGTGGCGGCGGCGGCCGCGGCCGC | p.Ala32_Ala33insValAlaAlaAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 12 | ENSP00000587864.1 |
Frequencies
GnomAD3 genomes AF: 0.0000402 AC: 6AN: 149098Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000655 AC: 7AN: 1069136Hom.: 0 Cov.: 32 AF XY: 0.00000581 AC XY: 3AN XY: 516198 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000402 AC: 6AN: 149098Hom.: 0 Cov.: 32 AF XY: 0.0000413 AC XY: 3AN XY: 72708 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at