chr11-77214658-G-GCCATGAGCAAACAGCGGGGCT
Variant summary
Our verdict is Benign. Variant got -13 ACMG points: 3P and 16B. PM4PP3BP6_Very_StrongBS1BS2
The NM_000260.4(MYO7A):c.6614_6634dupTGAGCAAACAGCGGGGCTCCA(p.Met2205_Ser2211dup) variant causes a disruptive inframe insertion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00126 in 1,589,124 control chromosomes in the GnomAD database, including 30 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_000260.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Benign. Variant got -13 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MYO7A | ENST00000409709.9 | c.6614_6634dupTGAGCAAACAGCGGGGCTCCA | p.Met2205_Ser2211dup | disruptive_inframe_insertion | Exon 49 of 49 | 1 | NM_000260.4 | ENSP00000386331.3 | ||
MYO7A | ENST00000458637.6 | c.6494_6514dupTGAGCAAACAGCGGGGCTCCA | p.Met2165_Ser2171dup | disruptive_inframe_insertion | Exon 49 of 49 | 1 | ENSP00000392185.2 | |||
MYO7A | ENST00000409619.6 | c.6467_6487dupTGAGCAAACAGCGGGGCTCCA | p.Met2156_Ser2162dup | disruptive_inframe_insertion | Exon 50 of 50 | 1 | ENSP00000386635.2 | |||
MYO7A | ENST00000458169.2 | c.4040_4060dupTGAGCAAACAGCGGGGCTCCA | p.Met1347_Ser1353dup | disruptive_inframe_insertion | Exon 29 of 29 | 1 | ENSP00000417017.2 | |||
MYO7A | ENST00000670577.1 | n.*1186_*1206dupTGAGCAAACAGCGGGGCTCCA | non_coding_transcript_exon_variant | Exon 32 of 32 | ENSP00000499323.1 | |||||
MYO7A | ENST00000670577.1 | n.*1186_*1206dupTGAGCAAACAGCGGGGCTCCA | 3_prime_UTR_variant | Exon 32 of 32 | ENSP00000499323.1 |
Frequencies
GnomAD3 genomes AF: 0.00698 AC: 1062AN: 152186Hom.: 19 Cov.: 32
GnomAD3 exomes AF: 0.00116 AC: 244AN: 210546Hom.: 2 AF XY: 0.000965 AC XY: 109AN XY: 112914
GnomAD4 exome AF: 0.000651 AC: 936AN: 1436820Hom.: 11 Cov.: 30 AF XY: 0.000563 AC XY: 401AN XY: 711950
GnomAD4 genome AF: 0.00696 AC: 1060AN: 152304Hom.: 19 Cov.: 32 AF XY: 0.00655 AC XY: 488AN XY: 74478
ClinVar
Submissions by phenotype
not provided Benign:5
See Variant Classification Assertion Criteria. -
- -
- -
- -
- -
not specified Benign:2
c.6614_6634dup (p.Met2205_Ser221dup) in exon49 of MYO7A: This variant is not exp ected to have clinical significance because it has been identified in 2% (73/340 2) of African chromosomes by the Exome Aggregation Consortium (ExAC, http://exac .broadinstitute.org; dbSNP rs111033388). -
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at