chr12-102958393-C-CGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr12-102958393-C-CGCAGCAGCAGCAGCAGCAGCAGCAGCA
• rs3832799
• NM_004316.4:c.160_186dupCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP6

The NM_004316.4(ASCL1):​c.160_186dupCAGCAGCAGCAGCAGCAGCAGCAGCAG​(p.Gln54_Gln62dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (no stars).

• Frequency:
  • Genomes: 𝑓 0.00053 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000024 (0 hom.)
• Consequence: ASCL1 NM_004316.4 conservative_inframe_insertion
• Clinical Significance: Likely benign no assertion criteria provided B:1
• Conservation: PhyloP100: 0.219
• Publications: 15 publications found

Genes affected

ASCL1 (HGNC:738): (achaete-scute family bHLH transcription factor 1) This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]

PAH (HGNC:8582): (phenylalanine hydroxylase) This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase protein family. The encoded phenylalanine hydroxylase enzyme hydroxylates phenylalanine to tyrosine and is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Aug 2017]

PAH Gene-Disease associations (from GenCC):

• phenylketonuria

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Myriad Women’s Health
• classic phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• maternal phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild hyperphenylalaninemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP6: Variant 12-102958393-C-CGCAGCAGCAGCAGCAGCAGCAGCAGCA is Benign according to our data. Variant chr12-102958393-C-CGCAGCAGCAGCAGCAGCAGCAGCAGCA is described in ClinVar as [Likely_benign]. Clinvar id is 3045630.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ASCL1	NM_004316.4	c.160_186dupCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln54_Gln62dup	conservative_inframe_insertion	Exon 1 of 2	ENST00000266744.4	NP_004307.2
PAH	NM_001354304.2	c.-321_-295dupTGCTGCTGCTGCTGCTGCTGCTGCTGC		5_prime_UTR_variant	Exon 1 of 14		NP_001341233.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ASCL1	ENST00000266744.4	c.160_186dupCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln54_Gln62dup	conservative_inframe_insertion	Exon 1 of 2	1	NM_004316.4	ENSP00000266744.3
PAH	ENST00000547319.1	n.-10_17dupTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	Exon 1 of 3	4
PAH	ENST00000551337.5	c.-321_-295dupTGCTGCTGCTGCTGCTGCTGCTGCTGC		upstream_gene_variant		3		ENSP00000447620.1
PAH	ENST00000635500.1	n.-198_-172dupTGCTGCTGCTGCTGCTGCTGCTGCTGC		upstream_gene_variant		3

Frequencies

GnomAD3 genomes AF: 0.000533 AC: 80 AN: 150120 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00174

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000198

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000210

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000742

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000236 AC: 32 AN: 1356954 Hom.: 0 Cov.: 17 AF XY: 0.0000299 AC XY: 20 AN XY: 669244

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000491 AC: 14 AN: 28512

American (AMR) AF: 0.00 AC: 0 AN: 33690

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24016

East Asian (EAS) AF: 0.0000899 AC: 3 AN: 33382

South Asian (SAS) AF: 0.0000132 AC: 1 AN: 75998

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 41214

Middle Eastern (MID) AF: 0.000490 AC: 2 AN: 4084

European-Non Finnish (NFE) AF: 0.00000661 AC: 7 AN: 1059590

Other (OTH) AF: 0.0000885 AC: 5 AN: 56468

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000533 AC: 80 AN: 150210 Hom.: 0 Cov.: 0 AF XY: 0.000491 AC XY: 36 AN XY: 73326

African (AFR) AF: 0.00173 AC: 71 AN: 40994

American (AMR) AF: 0.000198 AC: 3 AN: 15154

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3456

East Asian (EAS) AF: 0.00 AC: 0 AN: 5054

South Asian (SAS) AF: 0.000210 AC: 1 AN: 4762

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10154

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.0000742 AC: 5 AN: 67372

Other (OTH) AF: 0.00 AC: 0 AN: 2072

Alfa AF: 0.00 Hom.: 277

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: no assertion criteria provided

Submissions by phenotype

ASCL1-related disorder Benign:1

May 24, 2021

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.22
Mutation Taster		=79/21	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3832799; hg19: chr12-103352171;